Description :
Non Conding Region
Location :
Scaffold_1:42301- 42413
Sequence
112 bases(100 bases per row)
CTCCTCAAACGCTTTCTCTTGTAGGAAAACAAACAAAAAGCAACGTCACTAAAACGAAATCCCTGCTTTAGTGTCATCCGCACAGCGTCGTTTCGCATAC
TTGAAGTTGCCA