Description :
Non Conding Region
Location :
Scaffold_1:42266- 42789
Sequence
523 bases(100 bases per row)
aagaatgttagctgcttgagctccagcgttcgatccgtggttgtcgaggcttgagactcggtaaagttgactcgatctgaagatgtttctgggatcgtcg
tctagctagcgcttggcggtcttcagagctgaaacttcggattcgatcaaggttgatttcttcagcgtagctcttcattgccgcgtcgttatcgacaaca
ctatcggccagtccgcagcttcctgtggcattcgcaggcgccacttggaatgggtcgggaacatccacccgacggcgtcgacactgacgaaacaaaactc
tggcgacgagatgacgccgaaccgagagcaagaactgtattaacctgcacggtgtcatgtcggatatgcaatggacctagtggagtgacggaacatatct
gtggattgctctcggattgatggcaaatacgctggtcacaaattggacagacaacaagtgccaaagcactcagaatatgtgggcacgttcaatgtgtgtt
gtttaaaacataagttttaagac