Description :
Non Conding Region
Location :
Scaffold_1:42167- 42374
Sequence
207 bases(100 bases per row)
ACAGCAATAATCTCGAGTGGTGGTTCCCGTGGAACCGTTCTGGCAGAACTGAAAAGCGCGGGGGAACATCTCTTCCCCTGGtATTTTTTCAGCCAATCAC
AACACGGCAAAAATAACGGTTCTTCCCGCGCAATCCTAGATATATCTTGTCACAGTACATAATAATTCGTGTTTCAGTACTACTGAATCAGTAGATTTCT
CTGACCT