Description :
Non Conding Region
Location :
Scaffold_1:41708- 42114
Sequence
406 bases(100 bases per row)
CAGTCAATTGAAGAATGTATTGCCGGACTCTGAGAATGTGACGGCCAATCGTTTGCACGAACCGGTGTTGAAACATGTTGTCTCGATTCCACCGGCTAAA
GAAGACCATCATTATGTTTGTTGCAAATTAAGAGTGGGACTGTGGGACAACGGTCTCGAAACGGGAGATGCGTGCGCTTGTGGCCGATGAATTTCACGGG
CGTTTGGAGAGAGGCAGTCTTATACGTCAAAACCGAGGTGCGCGTTGACATGATTAGCCAGTCTCGACGGGGGCTGCTCGGGCACGGTTGGGAGACCGGA
TTTTGTGCCTTGGGCAGTTGAAACCACTTGGTGGTCCACATTGAGTTTTCGCAAAATGGGGCTCGACCCGGTTTGAATAAAACAACCACGCAGGTGATGT
GAGGTC