Description :
Non Conding Region
Location :
Scaffold_1:41658- 43895
Sequence
2237 bases(100 bases per row)
CTGTTCTTGTCCTCCTTGGAGCCGATTTGACTGGGCGCCGCGGGCGTGGCGAACGCAGTCGCAGCGACAGTGGCGTTCGCGAACGGATTGCCGAACGCAG
CGGCGGTGGACGAGGACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCGTTGGTG
CTGGAGGACGCGTTGCTGCCGAAGGTGTTGCCAAGGCTGGAGACCCACGCGGGGCCGNNNNNNNNNNCGCTCGCCGACGCCATCGCGATTGCTTGGGTTT
CGTGTTGGTGTGCCAACAACCAACCAAGAGATGCCACCTCAGAGAGGAAATATTACGGTTCGAAATGGTAATTTATGCCGGAAAAATGTACTGATGTTAG
ATTGTATCCATGTCATCCCTTCAACTTGACAGTGTGAGCTCGTCGAGCATACCCGCGAGCGTGAGCTCGGTCGCTGCCTCAACCGCGACGTCACGCAGCT
CCTCAGCAATGAGAGATTCGAAAAACTCGCGTTGGCGGCGCGCGGTAATGTAGCTGAGCGCCAGCTCCGACAGGGCTGTGGGTGGAACAAGAAGCGACCA
CTGAGAATCCACCGCCCCAAGACTTGGGAGTCGCTCTTACCGTCAGGGAGGATCTCGGCCACCAGCTCCACGATCCACTCAATCAGCAATTCCTCTGCAA
CGACATGCGAAGACGGTTGCGACAGGCGAGAGAGATCCACTCGAGACATCATGTACTCGCGAACCATCGAGTCCAAGGCGACCTGACCGCACACCAGAGT
TGCCGTCAGTGAGCTGACCAAGCATCACCAGCCAGCAAGTGTCGCGTCCAACCTGGAAGACGTCGCGGACAGAAGCTTCAAGCAGTTCGTGGTAGAGAGT
AAGGGAAAATGTGCTAAGTGCGGTCTCGCCGCTGAGCTGACCCATCACACGCTGCAGAAGACAGGTACAGTGAGACTCGGAAAACGCTCTCAGAAGGCAA
ATTCTCCAGGCTGTACCTGAGCCGCGTCTTCTCGCATCACGTCCAGCAGCGTGTCCGATACCAGGCTCGGGAGCATGTCCCAACGCAAAAGTGAATCAAG
TAGCTGTTCGGCGTGAGCGTGGAGCTGGGTCAGCTGACGACTGCGATTCCGCTTGCGGTTGCGACAGAAGCGAAACTCTTGCTACAGTTCAACGTCAGGA
CCAGTGACCTTGACAACAACCACCCAGGCATCAATACCAGCGTGCAGCTCTACTCACTTGGATGAGCCGCGCCGCGTTCCGTTGAACGCGTGCCATCGCC
TGCAGTGAGTGGACACGCTGAGAGCGTATCCCGTGGTCAGAGACCTCCGTATCTACCCAAAGCCCGTGAGGAATTAAAAGAACAGGCCATGGCACAGACG
CAAAGGATTGTACCGTCATCCTTGTGCGGCGAGGAGCTCGAATGGGCAGGACGACGACGGCNNNNNNNNNNACCAAAGCCCGTGAAGAATCAAGAACAGG
CCCTGGCACAGACGCAAAGCACTGTATCGTCACCCTTGTGCGGCGAGGAGCTGGAATGGGCAGGACGACGACGGCTTTGAAGTCGCGCTTTATTGTATCG
CTAGAAGACAAGAGAGTCTCTCAGAAGGATAGAGCAAGAGAGAGGGTAGAGCCACGGGCTGTCTATACCTTACAGGCTCGTTGTGGGTGCTGTTCATGAC
GTCGACCGAGACCATACATGTCGTACGAATTGTTCACGTCTTCGTCTCGGTCGTCGTGGATGTATCCGAACGAAGGTAGACAGACCATCGCCATCGGTGG
ATATGCGTAGCAGAGTGGGACGAACGACACTCCGTCCTCCTCATCTTCTTCATCCTCTTCGCTGCTGCGGTTTCGACGACGATCTTGACGCCAGCGGCGG
TGGTTCAATGGCTCCAGAAGGACTGGAGACGGCTTGCGCTTGCGGCGTTGGCCACCACGAACTAATCATCCCCATCGACAGTCAACATGCACATCACCAA
CCCACAGCCAACGGACCTCAGAGACAGACGCACCTCCCGCGACGCCGAGGTTCTCGCGTCCTCCACGCGCGTCGTAATGCACGTACGGCATCATACAATA
GAAAAGAAAGCCACGGGCGCATCCTTTCAAGGGGTTACAATTTGCATTGTTGTCTTACTTTGTTGGCGTAAAAATACAAGTCGGGGAAGATGAGAGATAA
ATAGATCCTCGCCCTGGGCGTCGGTCGTCTCTTCCTC