Description :
Non Conding Region
Location :
Scaffold_1:41641- 42203
Sequence
562 bases(100 bases per row)
GCGCTTTGTTGATGTGCGTCGCCATCGAGATGAGTTTGCAGAAGTTGCGTGGCAGACACGAATTGTGTTGGCCACTCGAAACTGGCGTGGCGCACATCGC
GCGATCTCAAATCTGCAAATGTCGGGAATTGGCTGCGGATTTCCGAAAAATCGTTGAAGGGACATCGGATCTCAGATGTGGAGTGCACCCACCGCATCGG
ATTGGATTGGCACGAGCCTGATTTTTCAGGGTTTTACCCGCGTGGTTTTATTTCCAATCCACCTCAAACGCGAGGTTTTAACCCAGTCTCTGCGCAGAAG
TCACTCGGACGGATCACTTTGGATTCTTTACTGAAAAAGGCTGGCAGCGCAGCTGGGGGGAAGCTCTCGTCCCGTCGCCCGCGCACAGTCGAAAAAGCGC
TAAAAAGGCTCGACGACTGCTCAGTCTTAAGAAACTCCACAGTAACGATGGTTCTCTCGGTGCGCAAGATGGTGGCGGTCGCGGCCGTGGCGACGGCGCT
GGCGGCGCTCGGCGACGTGGCCCAGCCGGNNNNNNNNNNNNNNNNNNNNNCGGCGCTCGAGA