Description :
Non Conding Region
Location :
Scaffold_1:41576- 41957
Sequence
381 bases(100 bases per row)
GACGCCGGATACGCTGCCAGGTGGCATCCGGTAAACAATGCCGCCACCCATCTTGCCCGTGCCGAAAACAAATCTTTCGAATGCCGAATATAACAAGGTT
CGACCTTGCCGTCAGCTCGCTCGCAGCCACGCCACAAGGGCAGGCCTTTGCGTCATGCAGTAGTTGCGACCAAGAGTGCTCTAGAAGATGCACCTTGACG
CGCTGGAGAGAGGTCTGATCGTCCAGCCCATCGCTGCCCAACAGACGCCACGGGCTTCGCTCCCAGGCTTGCAACAGGCTTGTCAAGGCGGTACTAGCCA
CGCTCGCTGGCACATTTCGCTGCAAGCAGCAAGAAAACGCTATTTGAAGTACGAAAAAGCGCTTGGCAAACGACAAGGCGG