Description :
Non Conding Region
Location :
Scaffold_1:41526- 41950
Sequence
424 bases(100 bases per row)
CATGCGCTTCCGTAGAGAGATACAGAGAAGACAAGAAGTCGCAAAAGAAAAGGAAGGAAGGACTACAGACACATAGCGATAATTTTATTAAAGTTTATAG
AAAACAAAGCAAATGGAAGACAGCATCTCAATCGCTTGACTACCCGACGCCTTTCTCAATCACATGTGAGTACTTTTCAGATTTCTCTCATTTATTTTGT
TTATGAAAATGCAAAAAAGCGCAAGTAGCGCGCTCTCTTCTTCATCTCTTTCTCTCTCTCTTGTCTTCATCTCCTTCTTCTCTGTCTTCTGTTTGTGGCT
TTTGGTTCGTTTTCATCTAAGCGTATGTTGTCGTTCTTTGTCTCTTCCTCTTCTTCTTCTCTCTCTCTTTCGCTGTAGCTGCTGCAGTTGCTGTTGCTGA
AACAAAAATGGTGGGCGTGTCGTC