Description :
Non Conding Region
Location :
Scaffold_1:41495- 42014
Sequence
519 bases(100 bases per row)
ATAGTGACCAACATGCAGATTTATTGTAAATACATGGTGTATATTTAGCAGCCCTTCAGCAATATGCTCCAATAATGCTGCATCAGTCGTCATCTGACAG
ACGAGATGGGTTATTAGATCGCTGATATCCCGAGACCCCAAGCGTCATCAGTCGCCGTCCCTTAGTCCAAGATTTGACTCAGACCACTCAACTGGTCGGT
GATACCAACTTGGTATGACCGATCACGACACGATAACTCTGCGGAGTTTGACGTCCGTTTCTTCTTCGTCATCCTCCGGCTCGTCATATGTTTTCGACGG
CACCAACTCGGACATTGCACAGCAGCTTTTCCTCCGCCACCGAGCTGGTGAAATTGGTAAACAAGTCAATCTCACTTCTGTCCCTGCTGCTGTTTCCGAC
CGACTGGATGCGCTCAATATCGACTTCGACGACCTCCCTGGTCTCGTTCAACTCGCTGTGCTCTGGGGATTCAGGCTTTGTCAATTTCCCTGATTATGAT
CCGATTCAGATCTGGACCA