Description :
Non Conding Region
Location :
Scaffold_1:41446- 42520
Sequence
1074 bases(100 bases per row)
GCGGTAGCTTCTTGTTCGGTGTTAGAGATCGCGGTAGTGAGCTTTCGTTGGTCGCTGCTGCTGCAAGAGCACGCGTTGAAGGATGTACTGCGTATCGAGC
GCTGCTGGAGAGCAGTGCACTTCTCTGCTTTTCGAGCGAAATGACTAATGGCGCCGCCGGTGCCTGGGCAACGCGGCGACGGCGTGCAATGGAAAGAAAC
GCCTCCAACTCGCCCGCAGCGTCTACTTGGTCCGCGGGGCCCAGAAGGAGTCGGTGGGGTCGCGATCGCAAGAAAGCAGAGGTAAAATGGAGAAGCAGCA
CCAAGAGAGCGTCGGCGATTTTTCTGGCGTGTAGCAGTTAGCGCTCATGCTAATTTTCGATCCCAACGCTCGCACGGTCATTTTTGCATGGCAACGCTCG
CGGCGGAACGCCGAGGGCTTCGCGTGGTGCAGGCAGGACCGCGTGCGAAAATCCCTGGAGCCGGAAGCGAGAGGCGTGCGAGTCTATCCGCGTCGCACGA
TCCGCGCTGTTGAACCCAAGCCCGGCAAATGCGAACAGGGAGCATTGGCGAACCAGTCGCTTGTGATCGTTGGGGCTCCGCTTGCACCTGCTAGCCCATT
TCGTGACGGCCTCCATGACGAGCCTCGTCCGCGAGTAAGAGGAAGCGCCTTGAGTCAGTGCCGAACAAAACGAACGCCGGGAATGGCGGCCCGTACACAG
CGCTTTTGCCGCTCGATGTCTTGACGCAATATCTGTACTTGAGTCAGGAAGCCGCGGAGCTCCGCGCATTATCAGGTTGCGCACCGCCCCACTCTTCGCC
CACGCACGGTCATTTGCGGCTAACCACGCCGGCGAGCGCTGCGATGAGTGGACAAGCTCCTGCTGATATTACATCCACTCATCGAGAGCCCATGCGGCGA
ACGCCACCACGAAACGTTCGGGGACGACACCGCAGCACCACCAACATCAAACTGCTGTGGACGCGACTCGCCATATCAACTTGATATCATCAAGGAGACT
GTCGCCAGTGGACTGCGTACAACGTGGCCAAGTGCACACACAGCGGGATAATCCGTTCTGGAAGACGGACACAA