Description :
Non Conding Region
Location :
Scaffold_1:41269- 41821
Sequence
552 bases(100 bases per row)
GGGAGTACTGGATTCCACTACGTGGGGTTGATCATGGTGGAAGAAGAAGTTTTGCGCAGTGACTGATGTCTCGTTTGGAACAAAATACTCCGCCACAGAC
TACAACACGTCAAGTTTGCTTCTCTATAGAGCCACCTGTCAGACAAGTTGTTGTCTGGGAAGCGCACACCGCTATCTTCGTATCAATAGATTAACTCAAT
TCGAGTCTCTTTTTCGTGTCGTCGATAGCGCCAAGCTGTGCTGTATTTAATCGTTCGTAATATTGAGGTAACGGTCGACACGGTCTTGGGCGACGCCGCG
ACGTGATCTTTCGGTGGGAAATACTGGGCCAAAAGGATGATGGCTGGCCACCTACTTGACTGGACAAGTACCCGGTATCGGGCTTGCGCACAAGGACAAT
CGTTGTTTTCCAATACGTTCTTTATGATACATGATGCTCTACTGCTACTCAAAACAACGAGAGCACAACGCTCTTTTCAGCTACGAGCTGTCTACCTCCT
GGTACCTTCGCCAACCAGTACGTCCGATAATTGGCCATGCTCGTTTCGTCCT