Description :
Non Conding Region
Location :
Scaffold_1:41236- 44741
Sequence
3505 bases(100 bases per row)
GTGGCTCAGGCTTTGAGACCACAGAGGATTCAGGTAGTCCAATCCTACCCGCGTAGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGCACACA
GCACCTTGCACAGAGGAAGTGCTAGAAAGCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCCCGGTCTAAGGGAACCGACTATGACTTAGACGGTAGG
TCTAAAGACTGAATATATCTTATAGGTGAGCCAAGCTTGATCCTTACAATCTCTAAGTCTATAGTAAAAGCTAAACAAGTGCCCAATGGTTGGCTCACCG
CCAACCGGTACCACGTACAATGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGTAACATGGATACACGTCGGTGTACCCCGTTACATCCTCCCCCAC
TTATCTGAGAACCACACCTTATTCTCCAATCAGAAGGGAGATAATTGGAATTTCCAACTTGGGAATTCCCGGGCGCAGCCACAGCACGGCTGGCGCGCCC
TCTCGACAGTCACGCAGTGACTTGTGTCCATGGCGGACACTGCGAGGTGCTTCCTTGCACAAAGGACGATGTCGGCCGCGAAGCCGACGTCCTTAGCAAT
TCGCGTTGCAGCGCTAGCAAGCGCACAGTGCTTCGGCACGGGATGCTACTGCATCCAAACTTGCGGTGGTTCTCCTTGATCACCAGCAGTTCACTTGGGA
GGGACCGTGGGCCTTCCCTGACACTTCGTGTGTCTTGTATCTCCCGTGTGGGTCGACACCATCCCGGGCATCACATAGCCCAAGAGTGGAGGGAGCTCGC
AGCTCACCTCCTGCCATGATAGCGGACCCGCATGGGCCACGCTAGTCATGGCTGAGCGCGTGAAGCATCGGCGCCGTACACGCGCTCAGGTCATTCGTTG
ACCAAAGCACTAAGCATCGTGCTTCGTCGTAGTGATACGACGGCTGCCATTAGCAGCCTGCTCATCACTAAGAGCATTTCGGGTAGAGCAGCAAGCTCCA
CCCCGCGTCTAGGTCGTCGTACCATAGACGATTTGGTGTCGGACATCGACACCGAGGTACCCATCGGTACTTGAAGCATGGTGGAGAGTTACATGCACTC
TCTACCACCTTCACTCTGGTGCCGGCGATTGCTTCGTGCATCGCCAAGACCAGAGCACGGTCGGAGTGTGTGCAAGCCTGCACGACACTCGGTCTTTTTC
AAGACCACGATGGCGTACGGGCCTGTGAGCCCATACGTCAGTGGTTCGCCGTGTACTACGGCTACCACGAGAACATTGAGATGTTCCGAGTGCGTGCAAG
CATGCACGGCACTCATCACCACATGTGACCGCGTCGACGTACGGGGCTGTGCTCCCGTACGCCAGAGGTACGCCGCGTGCTCAATGTACCACGGCTGCCT
CAAGTGCCGCAAGCGTGCAGCACTAATGCTGTACAGTTGTTGGCTCATGCCAACAACAGCTTCCGTGAGGAAGCTAGTCTCTCTAGAGACTTGGGAGGAG
AGGTATTTCCGAACCCCTCCCCCTCTTACGATCGACCCCCCTCCGGGATGACCGCGGCTGGAATTCTTCCAGCCCGGGAACAGTTTGAGTCTTGTGCGAC
TTGACGTGGAACAATGTTACCCACGTCGGGTGAAGCCACGGTAGGCTCACCTCTTCCGTGACTGGTGTGTAGAACTATGTTACCCACACAGGAAGCGCAA
CCCGCGTCTTCCTTTTCAGTTAAGGTCTGGGCGACCGGGCGCAATATACATTGCGCCAGGCACGACGTCAACCATGTGCCTCGTGCCGTGAAGTGAAACA
CTGGGTTCTTCGGGGCCCAAGCGCAGCTTGCGCTTCGGCATACAAGGTTCAGCAATGCTGACACCTCGGCCTGTGATAGCAGCTGATAACCGGCTGCACC
ATCGAGCCGACCGTGTCTGAGGAACATAGCTCCGAGTCGTTCATTGCGACTCCAGTCTGGTACGCGCCCAGACCCAACTTTCGGCGGCGACGGCGTCGTC
GGCGGTCATCAGGACGTGGAACTAAGTTACCCACGTCTTGGTGGCGGTGCCAAGAGTTTTATCGACTCCGTGTGGAACTTGGTTACCCACACAGGAGGTG
CTTATAGCGACCTCTAGCTGGCCACGATCTCGGCCGTGGACTTAAACCACCGGTCCGGTAGTGCCACTCGGCACTACTGAAGTCGAACCCCGTGCGGCGC
GACGACTTCTCGGCGATGGTCGCTGTGGTATAGCGCAGCCACACAAGCCGGACAAGACGCCCTGTCCATCGGCTAAGCCTTTGGCGGTCCGCGAGGGTTA
CCCGCGATAGACATGGTCTTGCGACCTGTTGACGTAGTTATGCGTAACTACGTCAACGGAACACTTCCAGGACGTTCCTGTCCAGAACAGAAGAAGAGTT
CAACTCTTCAGGAGAGGTCTCCGGTTACAGGAGTAGGTTCAGAAACTCTGACACCTCCGGCAGGGCGGTCAAGCTTATGACCCCCTCCTTGACCTGACAG
GTCTTGCCGTCAAAGATGTGATAGCATCTTCGGCCGGCCGTGCCTGAGGAGTGTTGATCACTCCGAGTCGCTCGTGGCGACTCCAGTCTGTTTCAACAGA
CTCGGCTTACGGCGGCGATGACGTCGCCAATGCCTACCCCGGCGTGGTTCTTCGTTACCCACGGCCGGTGGTGACTCAAGGGCAGAGTCGGGAATCTCAT
CGACTCCGTGTGGCACATTGTTACCCACACAGGAGGTGCTCTCGGCAACCTCAGCCCTGGCCACGGTCTCGACCGTCTTGGCCTCACGTGGACTTGTTCT
ACTGGGGAGCTGACATCCCCTGGTGCCGATACAGTCGAGGCCTGTATGGCGCCACGATCAGGAGCGGTGGGTGCTGCTGGCGTTGCAGCTCCCCTCGCTG
GACTATTAGTCCTGTCTACCGGCATTGCCTGTGGCGGTCCATTGCCCGCAGTGAACGGTGTCTCAACACCTGTTGCAGCTGCAACTACTCCGACGACTTC
CGTACGTCGGCGGACGCCATTGCGTCCTGGTAATCCTTTCGGATACCGCGTGTTCTGGCAGAGGTGGGATCATGACTCACCAATGCTCTGCCAGAAGCTG
GGTGCCGGTTAGCCTAGATGGCTTTCCGACACCAATTGCTTCAGGGTGCGTGCGTCCATGGCACGGCGCACCCAAGCGGACGCCGTACGTGTCCACGACC
ACGTACGGATCGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCTATGCAGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCG
GCGTATGAAAGCATTCGACGCCCCTGGAACTAAATGTTCCTAGGGATATTAACATCCCCGTACACTCACGTGTACTACTGGCAACCCAGCGTTGCCATCA
CCGATTCGAGACATAAAGTCTCTCGTAGGCTAAGCCTCCATGGTGTGCGCCACCCGCACACCCGTCACGGAGACTCAACTCTCCCCCCTCTGGGGAACCC
GCCAT