Description :
Non Conding Region
Location :
Scaffold_1:41185- 41541
Sequence
356 bases(100 bases per row)
ATGTGATGTTGCTCTTGCGAGAGCATGGTTTAACTTAAGTTTGAAAACATTTTGCCTCACTGAACTGTGCTCGTTACCTTTATTCAGGTCTTTAGCAGAC
ACACACCATCGCGAGAAAGCAGGTCTTGAGGTGCGTGCACTTGTTTTAGTCGCGTGGCGATTAACCAAAGGTACTCGCTAGAGCTGGCGAGGTGAGGTGA
GTCGAGGTGGTCGTTTCGTGACGATTTCCCCTATAAATACTGTTGTCGCCGAATAGCACGCTGCTGCGCTGATGGCAGAGCGGAGTAACGAGCCTTGCAC
GCGGCCTGCAGCGTAAATCGGCCGAGTACTTCACCCACTTGGCCCCACCCAAGGCA