Description :
Non Conding Region
Location :
scaffold_1:41169- 42740
Sequence
1571 bases(100 bases per row)
TTGGACGAATGCAGAGAGAAAGCGACGGCGAATGCCTGAATCTGTAGCACAGCGATCTGTCAGTTCACGAGTTCCACTATAGATTATAGCTCCAGACTCC
ATCCTCTCCCCCTTCCACGGCCCCCGAATCCAAAGAAAGATCGAGGATCTATCCACTTTGACCATCCGTGCGGCGGGGGAAAGCGAGCAATGGGAAGGCA
GACGCAGGAGGGGAGAGAACAGCGCTGCAGATGGCGCCGAATGCATCTTGCGGTACCTACACGAAGAGGAAAGAGGAGGTGGCTGCGCTTCGACTGTTCT
GAGCGTCTTGGGTTGTGCCGCGAGGCGGCAGTCGAAGAAGGAAAGAACTCGACCGCCGTTTCCCGAGGTTTTAAAATTGAGGTTTTTCAAGAGTTTCAAC
CAATCAAAAGACCCAGCGTGGCGCAGAACTTAGAATTTGGTGTGGCAAACACACTCTCGAGAGTTATGTTGCCGATGTTGAAGGTGCTTTGGTTTTCATC
GGCGTGCATATGACCAATGCACGACACAGACCTGCCAGCGTCGAGCCCATTGCCGACGTCCGTTGCGTCAAATGTGCGATCGCTGACAGCTAAATATACA
TTGCGTAACTGGTTAGACCGTGCATGAAGCTTACAGTCACCTGTGGTAACGGCGAAGAAGTGACGACAATCTCAATCGCAGCTAACTTGTGTCGTCGTCT
CGGCACCATTATGTGGAGAGAACACCTTACCGGTATGCGAAATGTTGGTGGCAGGAATACCTTCCACGATGCCCAACATCGCCGATACATATCCTCTACA
GTAGTCTCCACTGCTCCAATCGGCGTCATCCTTGTAGATTGGAACCCTAGTCGTGCTAAGGGAGAGAACGCTACTGCTGCTGGTGGAGCTTTGTAGCTGT
TGGAAGACGGCAATGGCACAGTGAGTGGCTTTAAGTAGACAAACTTACCTTGTCGTCTGCTTCTCTCCATGTATGTGCCCAACGCCTGCAATTGCTGTGT
CTCCAACCTTTGCGCATCGCATATTCGCGAACTGATTCTCAAGATTCTCTGGTTCAACAAGAGTGTTGGTCTCTCGTCCTCGTTTTCCGGATAATAACCG
CGAATTGTATAACTCGCGGTCTTTATCCGGAAAACGAGGACGAGACGCAAAGAAAAAGGAAGCCCCCCACATACAGAGTGGAAGCCGAGAAGAAACGTCG
AAGGCAAGTAACCAGATTGAGGCTCGGTGGACGGCAGCGTTCGCTGCACAGCGCCGCCTCCGCCGCCTCTTGCATGTAACTGTGTGTGTGCATATAGCGG
TCGTTCCTCTGCAGCTCGCGCTCGAGGCGTTCTGGGCGAGTAGAGCTGGCCCAGCCTGCTCCGAATCAGACCTGCTCTGCATGCCGATTCTAGTGTCTAT
TGAGGGTTGCAGCAGGCCAATTCGGAGTGCTAATAGTGTGCAGCGACCCTTCATCAAGTCGAGAGCGGGAAAGAGACTAACTGGTGTGCTGCTGTTTGGT
TTTATTGCAGACGTAACCACCTCGGAAACACTAGCAAGAGAAGAACACACCCAGTGTTTTCATAGCGACAA