Description :
Non Conding Region
Location :
Scaffold_1:40893- 41272
Sequence
379 bases(100 bases per row)
GTCGGGTAAGCGGGACGATCCTGTTGCCCCCTGCGTCAGTCTTGCTAATATATCGGGTGCTAGCAAGGTGCCGCCCGCTGAACATCGAAAAAACTGCACG
ATGCATCCAGCGGTACGGACTGATGTGCCGTCGACAGCAGCACCCAGCCAATTTGTATAGCACCATCGCACTGACGAAACGAAAGTCAAGTTCATCAGGT
TGTCAGGATTCGTTATTTGCCGTGCCACTTGACTCGCCATCCACTAACTGCTCGAGCACTACGTATGCAACGGCGTAATCTCCATCATGCGACAGCGATA
TGTGCGGTTCCTGCGCCACAGACATATTGACACGTTACACCCTCTCGTACCCACACAATTGGAGTCGGCACGACGTACC