Description :
Non Conding Region
Location :
Scaffold_1:40778- 44466
Sequence
3688 bases(100 bases per row)
GGCCTTCCCTGGTATCTTGAAGGCACATCCATCGTTTTAATTTGATGGCCAGTAGAATGATCTACCATTCTCCCTTGATACGTAGCAGAAGTAACCACTG
TTCTCCCCTGATAAGGAGCAGAAGTAGCTGCTCCTGTTGTCGTTCTCCCTTGATAAGCAGTAGCTCCATCCATCGCTCTCCCTTGGTATCCTGTGTCCAT
GGGCCTCGTCTGGTAACCTGCTGAATTGTCAGGAGCTCTCCCCTGATAAACGACAGGTCGTTCTACCTCTCTTCCTTGGAATCTCGATGCTGTAGTGTGT
TGCTGGTATTGCGTAGCTCCTGGGGGCGCTGAGGATTGGGGAGCCCAATCGCCCGATCTCGCTCGGTCTTGCCAAGCTCCAGCGGACGATGTGGCCACCC
CGCGGGCCGATACAGCCGAGGCGgggatgtagccatctggAGTTTTGCCCTTGCTCATGATGGCCTCCATCCACACTTCATTGGGCGGGGGTGTaaggcg
ctggcgcttctaACGTCGCCATTTTGTACAAAAAGAGAGGAAGAACAAGGGGGGAATAAAAGTTAGCAGGGGGGAGAGGAGAAGGGGGAAACACACGAca
cgaagaacagcaccTTGTCCCCGCGGTCCCGTGCTGCCCCATGGTACATGCTGCTAGCCGCTTCCTCGACGAGGCGTCGGCGGCTTGTGCTGCCCAAGGC
TTCTTGAGATTTGTCGTTTAGGCACCACAGAGACTGGGGCTTTGGCGCGAGTCAGTGATGTGAAAACGCATACATTGTACGATAAAATATGGAAAGGATG
TTTAGTATGTGTTTATGGAGGTGCCCATCGCGCTTGAGTGCCCAGGTGCCGACACTGCGACTCCAGTGGAGTCTCCACACCATCACAACAGTTGTGGCAC
ACAAGCTGCCAACTGGCAGCTTTGCTCCTTGagaataccggtaccggtattaAATAGCAAGCTCGATGATGCACCCTTTTCCtttttgtattttttttcg
gGCTCGCATTATATACCAAGTGAGGTTAATTGTTTCGACGATAAAGTTCTGCTATTGTTAATTAACACTCGCACCTTTCCGTGTGCAGCGCCACGAATAT
AATACAATGTTCACTGATAAGTTTCCTTCTCAAACACCGCTCAGAagattgtttttttttttttattttacatgtagttctAATAAAGGGTTAACCTTCA
CATGCCGCTAGGTGATCAAGCGAAATGCATGTACCCGTATAGACCAATTTCCTTAGATAGAAAACAGTCATATTACGGATAATGATCGCAGCGGTAAGTA
CCTTATATTTAACGTTGTagacaacaacaaaaagttACAGTGGTCTAAGTTTTCAATGAAGCATATCCGTAGTTTGAGAACTTTCAAATTAGGCGGCCCC
GCATGAGCTTGTCCATTTTTATCTATAGATTTCCGACCCGGCGCAATGCACCCTGCGATGCACTGCATGCGTTCATATGTTTAGCTGCATGTCTTTGGTC
AATCATTCAGAATTTACGTTAGAAATTAAAAGAGGTACTGTTAGATGCGAATTAGTCTTTAAAAATGTTAATCCTTGTAATGATCAGAAAGCATTTACCG
CAAAGTGTTTGTGTAGAGCTGAGCCTTTCAATCTGGAAGTCCAAAATGTTTGTTTGGTAAACGGCGATCGTTCCTCATCAATTTAGAGCGGGTTTCCCAT
TTAGTCGGAGTTTCTGAAAGCAGAACTTGCACATCTCGTAgttgatcttgatctgcttTGAGATGTGCACTGTACTACATTATGTAGTTTACATATAAGT
TAGTAACCTTGTAAGCTAACAGCGGATACGGTACTGCACTTTGTCGATAATTTATCGGATAAAGCCCTCGGCAATTAATTACCTGGTACTATTGTGCACA
CGTGAAAGGCACAATACATGCAGTTCATTTTACATGTATACAGTGTGCATTGCATGTGCATTCGTAACTTATAATCGTGCGGATTCAGGAGCTTAGTCAC
CGCATTTTTGTATGGCTCATTTATCGAGCATAAATAATATTATTTATGGATATCAAACGTTAACAgtttacatgtactactactgtacagGAAAAAGAAC
AGgacaggtacatgtacctacaTAATACATGATGTAGGTAAAAGTTGATTGCGTCTTGCAGACATGCTTCGCTGAGTCCATATTCGTTGTCGTGGGGGGC
TATTCATAGGAAGAAGTTCTGTTCGTTCTGActcgaagcccaagcgcGTAAGGTGCGTTTCGTTGTTAGTACTGTATTATATTCAGATGAGTGTCGAAAC
AAGACATACAATACCAGTGGCCTCGAAATGAATCTTCCAAGTTAGTGCTATTTGGCGCTGTCGCTTGAGTTTCCGTAAATTTAATTGCGCAACCTCCACG
TTGCGTCAAACACTATCGCAGTGTGTATTTCCACTGTAGCAACAGGTTATCCATCGTCTCTCCATCTTCTAGCAGCATTTGGACgggaacagcagaagct
tccTAGAAATGCCACTCGTCATTGACTCCACAGTATCTGCCATTTGCGTTAGCATCGGGCAAGTGAGAAAATAATGTTCCAATCTTTCGATTAAATCGCA
ACCGACCCTGACACAGGATTGTGCATTCGGATTGCTAGCtagcatgaagaagagccGTGATCTGGCAATAAGGTCTACGAAGAAAAGTCTCACGTATTGT
AAGCTTCGATGTCTGGTACCTGTCATTCACGCTATAAACCGATTGATACACGTCCTCGGGGATCAAATCCGTATTATTGGGTGTTGCTCCAACTCTTCCA
CACGCTAGATGAGTTTCATCCAGACTCTCGCTTTAGACCAGGAAAGAACCGTGATTGTGATCATTCAAAATATTTGGAGTCACCACTGTGCCTAGAGATG
GAGGTTTAGGTCCTTAGAACTTCTAAGTTAGAAGCCATCACATTAATTGACATCAATGTACCTCACCGTGAAAACGAAAATCTAGGGATGAAGGTGTTGT
ACTGCTAACTACTCTTCGCAGCACACCCGCTAATAAATGCTTCGCATACGATATCGCGTGGCAATATGCGTGATCCCAGCTTGTTTTCCACTATGGAACA
AAACcatttaaaaaaaacttcacTTAATTTAGCCAGTGGTGATCATTATCCAGGGACGTCAGCGAGACAAGGCTTGCTTGCCTTTGCGACAGCTCGAACT
TCGGGCCCCGAAGTGCATAAAGTAGATCTTCAGATATATTGTTGTAGACATTTTGGCTTAAGAGTAGCTTGGTCATCATTATCCTCCTCAATCCTTGTAG
CGTTGAATTTTTTTCCTACTTgttgcagactgcaacaAGTAGGGGGAAAAATCAACTTGCAGTGCACAGTAATGTTTGGTTttgtattaatacatgtatc
cCAACGTCTATGCCAACGCCTACTCTCTTCAGCGCGCAGTAGTTTAATCTATTGGAAGTATTGCTTCCGGTATCTCTTGTCCATCGAAAACTAATGATGA
GGGCCGAATAGGTACATGTCTATCTATTACTGGTGGGCAAGCACAGGATAATTACGCAGCAATGCGTAAAACGAATCGTGGCACGACCGTCACCTGGCGG
ACTAATTGATTCAATattgtagtacatgtacatgattTGAATAGTCTGATACGAAAGCTATCGATGCTTTCCACGGTTTAACGGGCCT