Description :
Non Conding Region
Location :
Scaffold_1:40754- 41124
Sequence
370 bases(100 bases per row)
CGTTGCAGACCCAAACTGGCGACTGTGACAGCTTCGTCGTTGCTGCTGCTGCTGTTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGG
CGAGGCACAGGAAGTGCGCTCATGGGGCAGGAGATGGGGGAAGACTCTCAGTGCACTGACGAAGGGGTACGGCGCTGCTGGTGAAGATACGCGGAGAGAG
GTGGAAACAGCAGTTGAATATGGGGGAAAGTGTTCCTTTTTCTGCTTTTTAGTGCATGTATGCTGATGGCAGCTCCGCAAGAAAACCATCAACAAAACGG
TGGGTGAAATGGCGTAAAGTGTCGCATTTTAGGCGCGTGGCATCATCTAAAACGGTCGCTAATTTGTATG