Description :
Non Conding Region
Location :
Scaffold_1:40264- 42506
Sequence
2242 bases(100 bases per row)
AGACTGTTGCATTCAGCAGCAGCAACATTGTTCGCAGGTGCTGGGCGCTGCGCAGCAGCCCCTGCAAAAGGTAGCACTCTTTTCGGTCCACCTGGAGGGC
TGTCATCGAAGAGCGGCTGCTGCATTGGGATCTTTGCCGCATTTGAGATTCGCGTCTCCGCCGACTTATTGCCGAGGTGTTGCTGCCCCCAAGGCTTTGA
TGGAGGCGTAGACTCTAAAGCAGACCCAAAGCCATCTGTGCCTTCAGCAGACGGCATCATTCGTCGCTCAAGGAGCTCTCGTTTGGCCCACGGATTGTTT
GACTGGATTGCCGGATCAGATCCACCCAGTGGCGGAAATGCGACTGGGTTCAACACTGGTCGTGTGATCACATTTTGGTCTGAGACCAATGTCGTCGTGA
TGCGTCTCTTCGTTGTCTTCACGGCGGGTCTCTGGACTGCCGGAGACGTGCCGCTGGTTGTCTTCGCTGGCGCGGATCCTCGAATCAGCGATGGAAAATC
GTCGCTTTGAAGAGCGAATGGCAATTGTTGGTTGGCGCCACCGCTCTTGGTCGGCTTCGCAGCGCGCAGTGTCTTGGTATTGCTTTCGTTAGCTTTCGTG
ACAGTGGTATTGGCGCTACTGTTCGCATCTGCGGCTGGAATTGCGCTGGTACTGGTGGCTGTATCACTAGTCGCTTGCTGGGAGTGCACGACATGGTGCA
ACTCGCTGAGAAACACGTGAATCAGATCGCTTGGCGCCCATTGCGTGGTCCTCGATCGCACCGCCATGGTCTTGCTCTTGCTGCGGACATCGTTGTCTGC
CTGATTGTTAAGGTTGGTATCCTGTTCTCCTTTGTCGGTGTCATCGATGAGCGTGAGTGGAATGCGCACTGCTGCTGGCGTGTCGTTTCGATCGCCTGGT
GCGAGTCGCGAGGCGCTCCGAGAGACCAGCAGCAGGTGCTGCACGCGCTCGTGCTCGTCGTCCGAGAGGCGGCGGATGGCCTCCCACACCTGCGCGCGCG
TGCGCTGGTCGTCTGCGTCGATGGCATCCGTCGTCATCGCACAGACGCTCCTGGTTCTTCTGCCGCGTGCTTCTTCTTTCGACTGGAGCTCCTGGCCGCA
TCGCCTATGTCGATTTTTGTTGTTGTTGTCGGTTTAGTGCGGGAAGTTTTGGCGCCAAAAACGGAAACGCCACCTGATTTTGTTAATTTGATAGATTTGA
AAAGCAACACAGGGCCTCTTTATATTGATACGACACAAAAAGGGTGAGCAAAATGTGGCGCGCGCCATAAAGCGTCCCACACAGTTGTACTGTGGGATGC
GAGCCATTTGTGTGCGATGGTGGCTCGTTTTTGCGCTCGGTCGCACCAATAGCGAGCTGGGTTATTTTGCTGATTCAAACGTGCCCAGCTGGCGCTTTAC
TTGCTTGCTGTTGTCGTGGAACGGCCGAGCATCTTCTAAAATACCCGCAATTTACTAACACTCGACTATAGATAACTGGGAAAAAAGCCGCTTGGTGGGA
CAATTCCTTGCACATGTGCGTGGGGCCAACTACAAACACGAGAACGCGCGACACTGGAACTGGCGCGGAACGTTAAAACGCGTCCGGTATCTTTCTTTCC
GGTATATGAAAATGTATACTGTAAGGCTGCCCCGTAACGGTGTCGTCACGTTGTCGCCGGTCGTGGCGTCGTCGAATTCCAAATTCTGTCCAATCGGTGC
GCTTCCTACGTCTCCCTCGCTGTTGTATCAACTCGCTCCCAATTGGTACCGAATCGCCACAGCGTGGATACTTTGCCGAGTGTCCACAGAACCTACTGTA
CTGTACCATCACAGGAAAGCCATCTCCGCAAATGAAACCTGGAGTTTTGAGCTGTTCAAGAATGTGGTTCACGTGGGTAGGGCAAGATCCAGCCTACTTG
CCCACCACCCCATACAAACGCCAAGTGATCTGACGTACGGACCAAACAAAAACAACAAAATGCAGCTAGGGCTCGGGTCGGCAAACGGTTGCGTGGGTAA
TAAGGTACTGCTGGCGATTGGCCGTTCCAAGGGACCGAGGAGGCATCCATTTTCCCCCATTCCCCCCCTCCCTTTCCCTCTGTCGCCGCATTCATTTCGA
AAGAGACAGCGCCGGCGGCATTCCGCATTCGCGTGCGTACGTACATACGTACAGTCGACAGACGACCCCTCAGTTTCCTTCGCTCACTACCGCATTCGCG
TGGGAACCGGGAACGACGGGGACGGAAGGAAGCAAGGAAGCA