Description :
Non Conding Region
Location :
Scaffold_1:40144- 40226
Sequence
82 bases(100 bases per row)
ATCGCAAATGCTTGATTGGCATCTCGGGGGCCACGATTGGTCAAAAACAGTTCTCCATATTAGCCGCTCGTCATTGAAAAAA