Description :
Non Conding Region
Location :
Scaffold_1:4006- 4206
Sequence
200 bases(100 bases per row)
CATCCCATTTTCCACCAGTCATGTGCGTCGTATGGATTTGAAATCAAAACGCAAAATTGGCTCTCGCACTCCGAAGAGGATGCGCGCCATACAAACTTCA
AGTCACGCGTTGCGCGGGCGATTTTGGCGCCGTGCGATTCAGTCGCCAATCAACCGCCTCGGTCTCAGCTGATACAAAGTGTGCGTTGGGCATAGGACGA