Description :
Non Conding Region
Location :
scaffold_1:39998- 40137
Sequence
139 bases(100 bases per row)
GTTTCCTCCCTTCCGCGCTAAAGTGAAAGTGAGTGACGAAGAAGATCTCGGGTTCAAATGTGCACCACATAAAATAGACCATCACTCTAGGCGTTACTTC
AACCAAAAATGCGGACAGTCCCTAATTGGAGCGACGCCA