Description :
Non Conding Region
Location :
Scaffold_1:3997- 8546
Sequence
4549 bases(100 bases per row)
ATTGAACTCTAATTGTTAAATGAACTGAAAACTTACAAAATTCTATTAACTGGATGAATACAAATGTCAAGTTTAAACCTGAGTACACCATAAACAATCG
TTTATATGAAACATATTTGAAAGTTACTTGTTTCAGTATATTTATCGACGAACGATACCGCCCGCTCCCGAAATTTTAAACCGAATCAAAGATATTGTGG
GACATCTCGTACTACAGCGGATGTAGATAACGCCCACCCACATGTTACGCAATATAATTGGCTTACAAAACAATATTTGAACCAATAAAAGCAAATACAA
AATTGCTCAAATTAATTAAATGTTTGCAAACGATAGTGACTTAGAAAAACTGCTCCCAATCAGTTCTGCAGGCATACTCTCCCACACCGTGATAGTTTCT
TTTATCATAACTAAACGTTTTTCAACAGCAGATTGGCTTTCGTTTACATGTTCTAGAGGCCATTTTGACGAAGCTTGTCCTCAATGACCCCATCACGCCG
ACGTCAAGTGGCTGACACACTGACGTCGCACTAGCAGACAAAGGGGCCAATTGGGGGAACAACTCCCAATGTACAATGGTCTCTGACTCCTCCGTTACGT
GCGTATCGAGGTTATCCAGCAGTATCACCGATAGGCCGTCGATCTCATACGCCAATAGCTTGAGGAGATAGTACTTCCACACCTTAATGTTCATCAAGGC
ATTTTTCTGTACTGCATACACGTGGCCTTAACGGATTTTTTTTTAGTTTAAAGCCAAATAAAATTGATTACCTTTGGGATACTAATGCATTTCGGTCTTA
GTGATGATTCCTGTCGGTGACCCCTCAACGATGAACAGTATTTGCAGTTTCGAACCTGAATCATTTTTGCAATTAGTAAGCAATATTAGTGAGTACTTCA
ACTTATAAACATACAATTTAAATATCAAACTTACCATCCTCACGAATAGTCAACACATCGGTCAATCTTGCGGGGTGCTTATTTGAGTGTCGAATTCGGG
ACGACTCGCCCCTCTTTGCCCAGATCGCACAGGGTGGCATGTCGTAGAGAATGGCAGTTTCATCTACATTGTATATGTCCGATGCTGGATAATGTCCGTA
CTGACTCCAAAATGTTGCGCTAAATTTGTCCCGTTTTTCGATCAAGGTGCTACTTATTTCCTAAAACGATTTTGCATAATAAAATGTGTAAAAAAAGAGT
ATTTCAGTAAAAAACAATTCGAATTCAATGAAATTACCTTTCCGGGATTTGGTTTTCACCGGGAGAAGTCATGACGATGCAAAAAGCGTTGCAACAGCTT
TATCAAAGCTTCATATACGCTCTCCTAGTATTTTAGTGTTGGCCGCATACGTTTCTAACCTGTCGTCGTGGTGAATCTTGACGCAGTACATCAGGTGGAC
AGTGCACAACACCTAAAATACAGTAAACGACACAAGAAACACATTACTTCCATTAGTAAATAAATAAGTTTAGATACTATAAACAATCACAAACATTACC
TTTTCCTCACGCCGCATATCTTTCATGAATGCAATGTGACGAAGTGCAACTCCTTTTCCGACTTGGCCACGACTTGAATAAGATGGATTGAAGGATCAAG
GCCAATCGACTGGGATGTCTAGGGTTCCTGACTCAGACTTATCAGGTTAGGGTTAGGGTCAAGCCAGAATTGGATCGACCCTATCCAGATCGGCATGAGT
GCAATCATTTTGGTACAGATTGTGATCTGATCGACTGCGATCTAGATAGAATGACACAATCATTCCGACATAGGTATTGCCTTTGTGGTATGCATACCCA
ACAAGATTCGGTATAGCTAGTGAGTGGTGCAAATCAGGTGATGTGCAAAAAGAATACGAGAAAAGATCGAAAAAAACGCTAAGGCATTaacagagagaga
gaggaatTTTTCCTTGTAAGACACAAGTAGTGTTCACATTTcggggaggggggggggtaTATTGGCCCACCCAGCGGCCCAAGAGCTCACTAAGTcgacc
aaggagaagacacAGAGGTCCCTGGATAGCTTGGCCAGGCCGTGATCCCTCTCTCTCCACTATCAAGACCCCGCTAAAGGAAGCGGCAAGCATCGAAAAA
TACACACCCAAGGACACCCCACCGTAGATCGGCTCCTGCTCAAGGCCCGATCTACTAACCTGGTGACCACGTGAAGAATTCCCGAGTGGTTGTCCCTCAA
TCAATCCCACATGCCGTCCACACGGTCCCGGTCGACCACCACTGACATCCTCGCTGAACGTTGGAAGGACGTAACCCACCCtaccgacgggtacacaagg
tgagaacAAGTTCAACATCTACATGGATCAGCGAAGCACCTCCTCCGTTATTTGGTAGTCcgggcaaccgttgacgaATTTGGATCGTGTCAGTAATTTC
ACGGTCCCTTCCTCGCCACACCCGTCTGTTATTTAACCGGCGAAGTGCTTGGCAGATTTCGTCTGCCGAGATCGGGCATGATAGTGGTTGTGCATCGGTG
TCCGGTGTGACTGGAGTCCGTGACGGAATGGAGAACTGATCTTTGAAATAAGAACGAACAAGATTGTTAGTCGTATATTGGTGCAGGGTATGCTTACCGT
ATGGGCCGTAAAGCAGTAGTGGCTGCGCATGCTTGGGTGTGATGGCGCGAATGGCTTCGAAGAATTGTGCTTTGAGGCAGAGGCTCTCGATCTGCTTGGT
AGTTTGTCAAGAGTGATATTTTGCAAGGTCACGGCATCTAAACTGGATTTAATGCATGGTCGCGTTGCGTTCGCGACGGAGGGcggcggtgttggcggtA
CGGTCGTTGTAGATGCGACGTTGAAGGGCGTGTTGTCGTGCTGTGAATTATGTGAGAATGACACTGTCGTATTTCGTGTGCCTAGTAGGAGAAGTGTTGG
GCTCCACGGTGGTCTCTGCGGTGCGGTGGATTGTCTCAAAGGTTTCTTCCATTGCGTGGAAATGGGGCGCGAGTCCGCTCGGTTGCCAGTACCGAGTGCA
CACTGTAGGGCATTGGTAAATTAATCTCgtgtgtcgtcgtcgtgaatGAGCCGTTCTCGTGTGAGCCGTAGTTGTTGACTGGACTGGGGTTGGGTTGGGT
TGGGTTCAAAAGCGGAGTCTCCGCTACTGTGCGAGTACAAAACCCGCGGTTACTAGCTTGTGCTTGGATGCCATTATCGCCCCACCCCACGACTATGTGT
CGATGCAGAGCCGACGGCAGTTCTGTGAGTAAAGGGTGTAGTAGATCTGATTGTAGATACAGTAGCTGGTCCTGCGTTGGCTCGCCGACTCCGAAGTATC
CTGAATATCCACTACCCCGGCACATTGCCAACGCGACACTCTGCAAGATCTGCCACAAACGACCACTACACCATCGAGTCATGGCTGCTAGGTGGGGGCT
CTAGAGTCACATTCTCAGGTGCCCCGACATTCCAGCGTACACACAGATGTCGACAAACTTCGTTCCCAGCGACGCGGGCAAGTGGCGCAGCCGACCGCGC
ACAATACTGCCAGTTGTTCTCGACGCTGATCTCGTTTCTAGTGGCAGCGGTCACCGACTCCGTACCGACCAAGATCTTGAAGAACTACGACGGCTCACCA
CTGACCAGGATCGATGAAAAACTTCTTTTTTTACTGTTATCACTGACGCGCTGCCCTCAGTGGGAGACTCGACGTATACCGACACCACTTTATGCCGCCG
ACTAGCAAAGTTGAGTCTAGCGCAGGTATAATTTGGCTACGCGAACACGTAAACCATCCATTAATTCCTTTATTCAAATAATCGGTAATCGAATCATCTA
TCTAAGCCTCTCATCCTGGCTGAGGGTGTGCACCTTCCACCTAGGAAGTGTGTGTCGCTACCGGGGCGGTATGGCACCGACGTCTGGTCGGTATAGCCCC
GTGTAGTGTCTGATCTGAGTCGCCTTCTGTGTGTGCACGCAACTGAAATAGTAGCTCCAGTCACAATGGCATTTATTTTACTTGGCGATTTTTGTGTTCA
TTTTTGTAAGGTTCGACTCAAAAATGTTTTGTACAGTCGTGAATGACCAAAAGACGCAGACGCTGACAAAGGATCGCAACTACGGCGGGAAGAAGTTAAG
CACCACACACGATGCTACAAGAAAGCTTAGGTGTCGGTGGTGAATCCGCCGCTAGCGCAAAGAAATTGTTGGCGCATGTACAGAAGATGGCACAGCTCGC
TTCTGTCAAACCCAATGCACTGACTCTTCGTGAATATCGCGAAGCATTAGAGGTTAACTACTTTGAATGCTGTTCTGGTTAAGTTGGGTATTCTAACCGT
ATCGGTGTCGTGAATAGGAATGTCTGAAATCAGAGGGTAGCGCAGCCATGAAGATTCTTGGCTTTCAACTTGCAGGGATCGCACCCAGTTGCTCGACACA
CGAAGTCTGGCGGTTCATCCTGGAAGCGTGTATCACAGAACTAGGAGGTTCTGAGAATACGTCAGTATTAACTGTAGCAGTTCATGTGCTTGGACTCATC
CCAGTGCCTCTTGTGCTGGGTTTCCTGCTCTCACCCGAGAGGGAACCCA