Description :
Non Conding Region
Location :
Scaffold_1:39924- 47322
Sequence
7398 bases(100 bases per row)
TCAACCGAACTGGGCTGTGCGCAACAGCCAGCAGCATTTTCCTTTGTTTGCGCAATGGTTGAAAGAAGACCGCACGCCTCTCTTCGTCCGTCTACACTCG
TAGTTGCAGTTGTCGCACTGCACCAGCATGCACTGCAGTCTGCAGAGCCCGGCGCGACCGGTTCTACGTTCGCTTCACTCCGACGTAGACCAGCGAAAAG
CGATCGCGCAATACATACCCTACGTTTTCAAAAACGCGCTCGCCAAACTGTGGCGACGGCGTCGGCAGCAAGCACTGTTTTCCGCCAGTCAACAGAATGT
GAGCTTATCATAGTCGACACCGTCGGGCCAGTCGTTCGTTCACATGGCAAAAATGTGCGGGGCGCTCAGATCCCATCACAAAGTATTCGGTCTCCTTTAG
AAGCATCCCGCAGAGCATCCCCAAGCTGTCGCCGAATGGCTGCCCAGTGAACTGTTGCATGATCAGATATACGGAGCACGCCACAAATCCCACTAACAAA
GTCAAGAGACGAGCCGCATCCAACAATGACAACCCCTCCGTTGCTATACAATTCGTTCTAAGGGGTCTTTTGGAGAAAGGCATCGTTAATCTTCAGAAAC
CTGATATCCTGTCGTAAAACGATATCAGTTAGGTCCACCAAGTCCCTTTCTAGGGATAACTATGGAGTAAAGTTGGTATTGCAATGGTAAGCTTGATACG
AAATGTTGAAGAAATTCTTGTATGTAAACGTATATATTATGGTCTATGGCAACGGCAGAGGAGAAGCTAGAGCTCCGACGAGCATTTGAAAGTGAGGCTC
CAGGCGGGGCATACAAAACAGCCAATTTGCTGCTTCTGGCAAGTGTTCGCACCTAGCTTCCAGCGAGCGTTGGGCGTGTGCTGAGGTATGTAAGTTAACT
AGAAAGCAATCTACATCTACACTGTAAACCTTACCGTTTTGTGTACGCGATTCGAGATGTTGCTATAATATGCTACACCACAGATCGTTTTGGCATGGAG
TTGACATTAGAAGGCCTGCAGTTGTGTCTTCGATCTTGGGGTTTCGATCACAAGTTGTATCAGCCTCTATTACGAGGCTGGAACAACTTACATACTCATT
GGTTTGATTTTCCTTTGCGCATGGAGTCGGAGGTGGGCGACACTTCGTGGGTCTCTTCTCTAAACTATCATACATCCTCGATTCATTTATGCCTTGCGTT
TAACTTGAGGTAACCTGAGTAACATGGCATATTGCTATATCTGATAGGGTAGCTGACCACCGGCCATATTAGGTATGACATAAGGATACTGCAATATCCG
ATTGTAAATATTGCGTACACAACCAAAAATTGATATTCTGGTATGCATAGTTACAAATGATTTGTACTCAACATGTATTAATAACGTGTGAAAGCAGTAC
TGTATCAATGCACAATATTATATTATCCTTTCGAAACTATAATATTGCAAATTGATACCGCTTGTTATCCAATTTATAACAAGCGTGAGAGATCGAATAC
ATATAGTAGAGCGTAGCAGGCGATGTGCGAATACAATGTAAAAGATAAAATGCATTGCTTTGATGAATTTAGAGTGAAACAGTTCCTCACTCATACTTAA
ATAAGTATCTGTATACAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTTCCAAAACATTTATATAACCTGTCCCTGACTCGTGAACCAGGCTCCAAGTGGCAAATCAGTATACTTTTCCTACTCGGCTATGAAGTT
TCGAAGGCTAAGACTTTCTTCGGAACCATAGATATCATTTCAAGAGGAAATAAGTTCATTTATTTTTTCCGCACAACAGGTAATATTTGTACAGTTCATT
ACCCTAACACGATTATCGATGTTCATGTTCATCACCACACTGTATCACTGGGTATTTGTATTGAACTCCATGCATTTGTGGTAATTACGGGATATAAAAA
ATACGGGCTAGTCTTTCACAGAAAATGAAAGGTGTAAGGATTGGACACGCAACCTTGCGTCTGTACTACTTGCCTGCAGCAAGCGAATCTACTTTGTGTG
AACAAATACCTCCGTCCGAACGGAGCTGCTGGGTGCTACCAGTATGACTGTGAATCTGATGCGGAAGGCGCGTGGTTATACTCATTACTACTATTCAAGA
TTCAAAATCGTCCTGTGGTGGGCCAGTTATATCAAAGAAGTAGCGTATGAGACCCAAGATTCAGTAGCGGGCTCCTTTACTGCCTCGCAGTGTAGCCAGA
GATCCAAGTCTTAGTCTAAAACTGAAGCCACTTCCCAATTTGCCTCGAAGGCCTCACTTATGCTTCCTACTCTACCCAGTCTATCAAGCCTCACTCTTCT
TTACACTCCTGCAACCTCCAGTTTTTTCCAGCTCGCCGTGTCCGCCCCAACAAAACGCTAATCGGATCTTCTTAGCCCTATTATAGACTTCAGAGGATAG
ATGAAGTCCTGGACTACAATGTTCAATTGACTAGAATCTGTTATGTCGTCAACTTTTCCGACAGGAGAGGCGGCCCCTTACTGCCTCTTCGCAAATAGGT
AGCGGGGACGGTCGGGGTCCTCAAACGATACTACAAGTGCTTGCCGGGTGGGGGGGTGATTGCTGATAATTGAGATCTGGTGTGGTGCTTATAGCTCAAC
CTGATGTTTAAGAAAGCGAACGCCAAATAGATCCGCCTATCGATGTCGTGCCGTGGGGTCCAAGATAACGCACAATGAGCTCATTTCATCCAATTAGAAA
TCGTAGTGATAATCGATGGAAAGATATATATATATATATATCCAAGATTTCACCGTGGAGAATGACGGTTAATGAACAGATAATGCCGAATAGAGTTCTC
TTCCAGATAGTACTGTCTGTGCGTATGATGCACAGTTTCGTGAATATTCGAGTTAAACACGAATTCGTAATTATTATCTTGAAAAATAAGTTTTGTAGAA
TGGAGACGCTAATATTTCGCACTTCATTTGTTTTTTCCAATAAATCTCGATCACAGTGTCAAATCACCATGTCAAAGTTGAGACAAGTACGATCTGACGA
TAACATAAAGGTCCAGGTCAGGACTTTCACCGGAATTCTTTTCCGAGCAGGCGTCTCCTTAATAGGCCTGTCTATTTCCACCCTCGCCACACTATCAGCC
TGCAACCACTTCCCTACTGCCCACCTTTGCTACTGCCCACTGAAACATTCGTAGCTATTGGATGAAGTATAGCGGAGTTAAACTGGCGTTTATACCAGGA
TACTCGAAATGTAAGTTTTATAAATAATTCAAAGTCTTACCGATAAAATACGATAATGTTGTGAATATCAGAGTATGTCAGCTGCGAATCAGTTGCACTC
AAAATGACACAGTTAGACCCGAAAATAGCGCGGCTTAGACTAATTATGCGTCTTTATTGCGAAAACACAATTATTCACTGCATATAGTGTTGTACCGTAT
ATATCACAGATATCCAAGCTACACACCCATAATTCGCGAAAATCTCACTTTTTGCGACTGTGGCCTAATATGTAGTGTCCTACGGTCTTTTATGTATCGT
GTTGGCGACGCATGATTGTGTACAATAACGGTATTAATTAATAACATCACTTTCAGCAATAATACAATCTAATATGTAAATAAGTCTAAGAACGCCATTA
AGCTGCATATTATTGTGCCTTTCCAAAGTTTTGGCCAATCTGACCTTTAAAGGCTGGTCCTAAGCAAGGGTGGGTAGGGCTAAAGGTGGGATTTGAGGAC
GAACTGAAGTTGAATTGCTAAGCCAGGCCACTAAATAAAATGATATTTGACCAAGAACACTGTTTGATTTTGCCGACTATGATCCAATAATACTTGATTG
TGGAGGTACTACGTAAGGGCTCCGATTTAGTTTAACAAATTAAGGCTGAATGGCCAGAATTTGCCGGCCATTTACCCTTACGTAAGGTATCCACAACAGA
TTGATTTTAAATCAAATATGGGCTACTCATCAGACATACGCTGGCGTGGCATTGTCTTGCAGTATGTCTACAATATTGAGATCAGCGTAGTTGCCGGTGT
ACTGGGCGTCTCGCCCAGAAGCCTTCGGAGATGGTACCATCTCTTCAAGACAACAGGAAATGTCGACGACACCCCAAAGAATGAGCGGTCACCTAAATGG
CCGATTGAAGTGCAACAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACACACACACACACTCCTTAGCCTTAACCTTGATGAA
TTGTTCGACTTTTCATTAGTAAAATTTCTCTATGTTCATACCTAGAACTAAGTAGTCATACCTTGTGACGGGCTTCCGTCACACGGTGCTACTGCGCCCA
CCGCAGTAGCCAATTAAAGTCTAGTTCCACCTCACTGGTTGGCGTAGTCGCAAGGCCACGCCGGTAACTTTCTTTAATCAGAGTTATATCTACCAGCTTC
CTCGCAACTGTGTACGCAAGGTAACGAACTCGCTAAGCCCCGTTACACCTGGTAGCACTTCGTGATCCACCCAACGACCAAGATGAACGACACGTCGATG
AGCGACGCGTCCGAGATGCCCAGCACGTCCCTTGAGCATGCCAGCTTCCCACATCTTTCTTCGATCAAATGGGAGGCGTTGCATCGCCTGGCCGCCGCGT
CCGGCGAGGCCGTCATCCAGACGTTGCTGACGGCTGGCTCTGAAGCCCAACAACGCCTGTCCGCCCAGGAGTTCATGGCGCGTGAACTCGCTGACCTTCG
TCAGCGAGTGTCGACTCCCATGCTCACTAAGAACAAGTCTGACATCGTCAAACTCGATGTCTCCTCGTACAGCGGTGAAGGTGGCGACCGCCTTCATCTA
AACCGGTGGTTCTGCGAAATCGACATAGCCGTCGAAGCTCGGCAAGTGTCAACCGAGCTAGCCCGGACGCGTTTTCTCCTCTCCAAACTTACTGGGAGAG
CGAAAGATTGGACACTCGGATCGCGTTCGAGCCGCCCCAGGACGAGCGGATTCAACGCTCGGCCTTGCTATCACTCAAGCAGGGCGACATGCCCATGCTC
GAGTACATCCAGCGGGCGTTCCATCTCATCTCGTGCATCACCTCCTACCCCGTGGACATGGCGACGCAGGTCCATGTCTTCGTCTCGGGCATGAACGCTG
GATACCAGCGCTTCTACCTGACGAAGACTTCAGCGTGACCGCTTCGCAAGCATTCGACTTCTCTCGGGCTCCGGCACCTGAACCGGAGCCGGAGCCAA