Description :
Non Conding Region
Location :
scaffold_1:39835- 40255
Sequence
420 bases(100 bases per row)
CAGCCTCATCATCGAATTGAGATATTTCATAGCATCATTTGTTCACCATGTAGCGATAGACGAAGAACGCAACACAAGCAGCTCAACTTGTAGAAAGAGA
AAGAATATACCATGTATAGGGTCACAACTAACCATAGTAGCATTCGTTGTCGCTCCGTTCAGCCAAAACCGAGAAAGCGATACCTATGAGAGGAGCGCAG
CGCCAACCTGAAAAAAGTGTGGCCTGATACCCCTTCCAAACGCCACCGAATCCTCGAACAGCCTTTTCACCCACGCCGCACACCAGCCTCATTGATCTTT
ACCCTGTTCTGGGCCTCTAGTGCCACACTTCTCCTGCGTCACTACACAAGACTCCGGAGCTAAACTGCAGACAACTCAACCAGCGCGCGACGCGAGGCAA
CAGGACTAAACGACAATGCT