Description :
Non Conding Region
Location :
Scaffold_1:39769- 40084
Sequence
315 bases(100 bases per row)
GCACTTTTTTGTCGTAAATACGTGAGAAAGATACATGTCATTTAATATTTTAAAAATGATTCATTTAACCATGTACGTCGTTCGATTGCGGCCACTTCTA
AGCGCGTAGGTAACAACATTCGGGTCGTATGATGCGCGCATGTCACCACACTTCCTCCGTCGTCCACCGCGTTCTGTCCATGGCGGTCCTTACACACGGA
CACACGCTTCCAGTGCCCCTCCATCCCGTTATTTATACCACATTTTTCATTTATAGCCGAATTTATATCGGCGAGATGCCATTGGCTGGTTGCAACCACG
TTTTTCCATTTCCAC