Description :
Non Conding Region
Location :
Scaffold_1:39619- 39880
Sequence
261 bases(100 bases per row)
CCTGCCCGTGTGTCGTCGTAATGATTAACTTGGCGCTCGATATATGTTGTACTCTATCCTCTTGAACGCTTGCTCCTTTGTTTCGACAGCTCATGGCCGG
TGAAGAGGAGCCAGGCGCCCCGAAGAGATGGCTCGAGCCAGAAGGTTCGATCCAGCGACCGTGCGTGCTCCGTGGGATCGAGCGCTCAGCGGATTGCCCT
CGGATGGTTAAAGAGGTTAAACCTGTTTAACGTACGCGCCGACGGCCACATTTGATTTCAA