Description :
Non Conding Region
Location :
Scaffold_1:39398- 39558
Sequence
160 bases(100 bases per row)
CCCCATTTTCATAAGCCAGTGACTGAGAGAATCAATGCGCACATAGGGAGAAAAGAGTCATACTCCTTCGTTCAGGAAAATAACACGGGATATATAAGGA
AATACGGAATATAACGACCTGGCTGAGGCAATGCGCTTCTTGCTTCTTCTTTTTCTCACT