Description :
Non Conding Region
Location :
Scaffold_1:39369- 39803
Sequence
434 bases(100 bases per row)
TCAGCCAACGTGTGAGTTGTCAACGTCTTCGCAAAAGATCATAAAAATGTAATGGAAGACGAGTTTTGTATTCTCCAACTATGCAGGGTTAGACGAGCTG
ACTGTTCACTCGTTTGGTGCTACGAACATGCAATACGTACTGCTACGCAGCTTTGAATGCGGTTTGAGCATGACAAGGCCCCCGGTGTGTCGAAAGCCAT
GCCGAAGCTCGTTACCTCGCGGCGAGACCTGCTCGCTCGATGTGTGGAGCATGGAAATGCGAATCCGGTGTGGGTTCGTGAATAGATATCGCCGGCTACG
ACACTGACAACAACGGGGCCTCTCGTGCTCGCCTGTCGATGAGAGAGACCCCGACGTATTGGTCGTCACCGTGCTTGTTGCTACACACTCTTCCGACGGA
GGGTGTTGAGCTCGAGGACGAACAGGTTCGTGTT