Description :
Non Conding Region
Location :
Scaffold_1:3913- 4231
Sequence
318 bases(100 bases per row)
CGACGGGACGAACGAACCTGCGACGTTGTCTGGTGCTGTTGTTGGCAAAGTGTGCATATCCCTCCTCGAAGAACGAGCCATCTGTCCATCTTTCTTATGC
TTGGCTCAGTTTTGCTGCTTATTTTGATCCGCCGTCATTTACTTTGTTTCTCTCTTTTTGGGTGACGATAAGTACTACCGGTAATAACGTATGCTATCAT
CTTGTGTGCCATCGACTGCACCTGTGCTTGCCATTCAATTTTTACGGATGACCACCGAAGTGGTTCCAGTGCTTGCCATTCTCTACACTCACTCGTTCGT
CTTCTGCCTTCAATCGTC