Description :
Non Conding Region
Location :
Scaffold_1:39076- 40816
Sequence
1740 bases(100 bases per row)
AGATTGTCAAATGAATCGTTTGAAAAGGTCCTCTGCCAACACTATTGACAGAGGACGATGTTACCCATACAAACACCAATATATTTGTGAATGAAGGTCT
TCACTCCGCTGGGATTTCACTGCAGCATCAATGCGCTTGTCGAAATCAAAATGAGATCACCATGAGGCCGCCACGTCAGGAACGAATTTTAGCCAATGAG
AAGCCAGGGAATTTTAACGGGTGCCGTCAAAAGTCCAAAGCATCAGAGTATTTTGCACATACCCCAGGCGGCACCACTCCTTCTCTCACATGCTATCAAT
TTATCGAACTATGAATTGAATAAATCATGAATAATTAATACAAAGGTCAATAATGCGACACATATAAGGTGTGTTGGTCGTGACATTTTGCATGTGGGTT
TTTTCATACATGAGTTTCAGAAATATTTCAGAGCGATTGGGAAAATTTCGTTATTGACGCTGCACACTGCGAGGATGTTGGGAGTGAACTCTGTCAAACA
TTATTCGCTCCTATTAACACAATTCACTTTGGCAAGACGGGTGACGCGAGAGTCCAGGATATTTTTCTTACAAAACATCGACAAAGCCAAAGAAGACGCC
GACGAGGTACCCGTCAGGCGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCCACCAAGGAAAGACGTGCT