Description :
Non Conding Region
Location :
Scaffold_1:39072- 39526
Sequence
454 bases(100 bases per row)
TCAAGTGCTGCGGACGGATGTTCGTCACAGAATTTACACGCTTTGATGGCTGCTATGATACATGATATGTCATCGCGCGAAGACACTATGGCTCACAGTG
TCTTCAGTCCATACTGTACAGTCCTGATCATGATGACACTGACCGACAGCGAAATGTGCTGAGTGAAAGTACATCGGTATTAATTAAACTACATGTAAAT
AACGATAAAATAAAACTCAACGGCCGGGAACTCATTAGAGCTAGCTTTCTTGTGAGTCTCTCTAAATCCTCAACATATTCGGCTGATGCGGTAAAGCCCG
ATCGATTCATCCAGTTGCTACTCTCGTCGGTGCCACATAACTGCTCCAGATGATGGAGATCCATCTGTGCAAACTCCCCTAGAGTCGCCATCACGACTCG
ATTCTCCTGCCCGCATGGTGCGCATTCTTAGAATCCCAGACTGACTCGCAGTCA