Description :
Non Conding Region
Location :
Scaffold_1:38731- 38937
Sequence
206 bases(100 bases per row)
TGCGTCTTGTTTGGGAATGAACAGTCGGGCAAGGGGCTTTGCCCAGGGAAAATATCGTCGGTACCGACCACTACAGTAGTGATGAAATCGGTGAGTTCGG
CTCATGCGCGCGGACGTAACGTCTGTGGATAGGTACACACTGCATTGACCTGGTTATGGAGGTGCCTCGTCACCCGAGCATAGCTGCTGCGTAATGTGCC
AGTGCT