Description :
Non Conding Region
Location :
Scaffold_1:38703- 39915
Sequence
1212 bases(100 bases per row)
GGCCCTGAAGGTAGCACCCCTCTATCTGTATCCTGATTCTCGCCACCACAGACAAACGCTGCGTAGCAACATTCCTCAACTATATTCACCACCATCTAAC
CAACCGACGCATTTTCCAGTGAAGTCATGAAGAGATCACGGCAATTCGAACGAGTGGGATTGGCGGATGTCTCGTGCGAGTCGTGGAAACCAAAACAACA
ACAACAACACTTGCGTGGTGATAAAAGCTTCTTAATTTATATTCATAATGCACGTCACCTCAACCCTCCTTCTGTTCCATATGCGTCAATCAATCACCTG
ATGATCTTCTTGTCGTTGAAAAGTATCCATTTCCAAAATCGAAGTGCTCGTTTCGGCCCTTTCTGTCGTCCTGTCGTTCCATGTCGCAGGGAGCCAGAGT
TGACTTCAAGGTCGGACCATCTTCTGAGTGCAGATACTGAACCGAACGTCCGCACAACAACCGTTCGTACGTACGTAAGCAAAAAGAGTTCAGACCACAC
ATTCACATGCTCAAATGGAGAGAAAGCAAAAGTGGTAGTTGACCAGACAACGCCAGCACGCTTTGTTTGTCTGTCTGGTTACAGTATATGAATGATGGAC
TCATACTCACTTGAAGCTGCTCAGCACTTTCAATGGGGATCTATCTTGGAACAGCATGCTCCAGTTTCCACCTGGTACTCTCCAGATGGTCTCTTGCTGG
TGAGTAATCTCCACCCAGCGCGACACAACCCAAGAGCCCAGGAGCTCACTTGAAGTGCTCCCTTTGCAAAAGTCCAGCGAAAGCCTGGTGCCAAAAGCGC
AGATCCTCTTCTGCCGATCACGGTGCTTTTCCAGTTGGAGAACGGATTTTCTGCTTCTCTCGCACACACACTCTCTCTACTGGAGATCAGTCTCCTAATC
CGCTTGGCTCGAGTGATTATTAGCGTCTGATTAGAGCGAGACCAGAGAGTTTAGGTAGAGAAGCACTGTGACCTGCTGACCTGCTGATCTCCCTGCTATT
TATTTCCGCGACCTGTTTTGTTGCTTTCTTGTCGGCTCTCTCTTCATAGCTCTGCTTGACTCTGAGGCTCGCTCTGCTGTTTTTAGCGTCATTGTTACTT
TTGCAGTTAGACTAGAAGAGGCACTCGCCACAAGCTTCCTTCCACTTGCTGTTGGGCTGTGAGCAGATCGTACACACCGGTACCCAAGAGCTAATACGAC
GAGCAAGCGAGA