Description :
Non Conding Region
Location :
scaffold_1:38672- 39358
Sequence
686 bases(100 bases per row)
TCATTGTGCTCCGTGTCGATGCTCGTCACGGGTGCCTCACGTGCCTGCTGGAGGGGCTGAGGCTGGCCAAACGACGAAGCATATTGCCCTCTCGGCGAGT
TAGCGAACTCCATCTTTGTCAATTTTTGCAAAATGTATCTTACCCGAAACAGATGGGACTATTTCTACATATTTTGCTCCGGACCAAATTTGAATTTCTG
CTGAAAAGCAACTTGTTAGCGCAATGTTTGCTGTGAATGGGCCAAGCGGACCTACGTCACGGAACGAGCGGCGTGTAAAGAGTAAGCAACAACGAGAAGC
AGAGGAGGAGACCAAGAGACAATGGGCTGAAAAGAAAAGAGAACAGTTCTTCCGGGAGAAGCGTGCGGAAGCTGGAAGTAGCAAACACGGTGAACATGGC
GATGTTTGTAAGGACAACTGCAACATGAAGTTTACGTGGTGTATGGTGTATTGAAGGAGAAAAAGAGCAGATGAAGGAGTGCCCAGCACAGTCCAATATT
TTTAAAGTTTGTTGATGCTGTCGCTGCGGGTTGCATTTACCCGATTGACTTTTTGATTTGTTTGTTGATAGGGATGTCGGATTGTGTTCAATGGCCGCAC
AGGGAAAGTGTCGTCGTACGTGGAACACGAAGGACGTTAATGTGTCGTTATTGTCTATTGACTTTAACACCTGCTTCTGATTCACA