Description :
Non Conding Region
Location :
contig_1:38524- 40359
Sequence
1835 bases(100 bases per row)
CAGGTCCCCATGGACCGAGGACACGTCCTCAGACTCGCCTTTGTGACTTGGCGCGTCACCTTCGTCGTGTGAGACTGCTCCAGGAGAGGAGCAGTGCTCA
AGGTCGCTCGGCGACCCAGGACTTCGGTCCCGATGTACAAACCGAGGGTTTGGACGGTCGTCCGGTGGTACATCGGGCGAACCACGGCGTCACGAGCGCG
TGTTCGCAGACGCGGATACGGATGCGTCGCCAGGCGAATTAATCGCCTGGGAAGCCGCATCAACGGCTTCCCCCAACGCGGAGGCCTTGCCGCGAGGCTT
GGCCGATTTAGACTTCAGGGCTTAGTCCTGGACGCTTTCGCGTCGCGAGGTGTCTTCCTCTGAGGCATCGTGCCAGGCCGACGTGGAGGCCAGGGAGCAC
GTTTGGGAATGCCCCAGTGCTCCGGGAGAGCGGAGAGCGCGAGCGGAAACGCTCGGCCTCTTGTCGATGGTTATCGACCGAGCGAGGAAGTAAGAGAAAC
TTCCCGCTCGCCCCGATTGGTCGATAAGTTCGAGTCTAAGTGGGGGAGGATGTTACGGGGTTACCTGAAGAGTGTCCGTCACTCTTCCGAGTTGGGTACA
TGGTGTACCCAACATCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAACATATAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGA
CGATCGCTAGGTAACTAACTATAAATATATCAGTCTAAACTACGTTGTCTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGG
AGTTTGTATACTCCTAACACTTCCTCAAGCGCAAGGTGCTGTGTGACTCCCGTCACATATAAAGACAACCCCAATATAGAACAACTCGGTCCTGATACAA
GATCCGAAATTATAAAGTCGATTTCACGAAAATAATATAACCTCGAGTTTATATATAGGCAATATATTAGCGTACGTACCAGAAGATTAAAGAGATTGAA
TATTCAAGCTACCAAGTGGGATAGCAGCTACCGCGTCAAAGTGATGGTAAGATGGTTATATGTTAGTAATATGTCACGCCCAATCAATCAAAGACTGGTT
GCGAAGGAGTACAATGTCCATTGATACTCTTAAGAAGTATATGTCGCCAGACTACATTTGCGAAGTAGGAGGACAACCGAAGACGAGGCACTTGCTTGCA
AGAGAGTAAAACTCAAAGTGATTCATTCAAAGCTCATGCCTGCAATGCATGCCTTCAATACGTGCCGTGCACAAGGAGGAAAGCATCAGCCTAAAAACCC
TTTTGAAGGCTGACCCAAGTACCATTTTTACAATGGTAATCATATGGAATCTCACCTATATGAGGGAATTGAGCCATCTGTTTTCTATGGCAAGCTAGAG
AACGTTCTTTCTACTCAAGTGAGTTCGTTCAAGGTAAATATTGCTCTCGGATACGAACTTGAAAGTAATGTCGATGTAGCTATTGTTAAGGTCATTGGAT
ATCCAGTTTTATATGGACGAGTATTGGAGGACCTGCCTATTCCACGACAATTTATATCACAAGCACTGAAACTGTTCATCAGCACGCCAAGTCCTTGTGC
GCACACGCCAAGATGACGATGGACACTACAATCGACGCACCGCCACCACCAATCTGCAGGTAATACTGCACAGCAGACAGCCGCACTTTTGCTAAATTCG
AGCCAATCACAACACGCATATATCATATTTTCAACCAATCAGAGTTTCATATCAACTACGGTGCCTTGTCAGAATCGAATCAACCAACAATTTCGCATCA
CATCCTCCCCACCCGCTGCCGTGCTTTCGCCACCA