Description :
Non Conding Region
Location :
Scaffold_1:38486- 43739
Sequence
5253 bases(100 bases per row)
TAAATGCTTTGCCCGATCAGCGGCTGGAACGGCGCGTCGCGAAAAAGGAACCGCAAGTTGCCCGTGCACATGATGACCGCCGAGGCGGACATATCGCTCT
CGTCGTCGTTCTCTGGGATCGCGTCCATGAGATCCTCGATCTCATCCCAAGGTTCACGCGCGCGTAGGCGAGCACGACAGTGTTGTATTTGTTGTCGAAC
AGCTGCAGCGCCATTGACACGTCCGAGCGGCCACATCACGCACAAACGTTACGAGGTCATGGCCGAGTCCATCTTGAAGTACTTGGCGATGTTCAAGATA
CTACCCACCACTTGCACCCCAGGTGTGCGGACTCGACGGCCACGCGGTTCAGACTGATGCAGCCCGGGTGCTTTTTGTGCCTTTGTTGTTATTGTGCACT
TACTAACATGTTTTTGTTTTTCTCCAGTTTGCTTGCAGTTTATGGACGAGTACCCAATCATGGACAACGAGTGGAGCGACCAGAAGCTCGTGCTGATCGT
GGGCGCGCTTTCATGATGAACCGCCACCAGTTCGATCTCGACGTGCTGCGCGACCAGCTCCAGAAGCAGCACCACCGCGGCCTGAACCCCGGTATGTGAT
GTGATGGGTTATGGCAGAGGTATGGTATATGGCGTAGCGTTGTCACTAACAGTTTGTTGCCCCACAGGTGGTGGTGAGATCACGCTAAGCCCGTACATGG
TGCGTAATCTACCCAAGCATCTGGACCTCTCGTACGGCGACTCGTGCCGCGTCGCGACGAGTGGCAACATCACCGAGCACTTCAACACGGACGTGAATTT
AACGGGCTACAACTAAAAGACTACGACGACCGCGGCGGTGGCTAACGGCAGTCGCCTGTTGGCACCGACAACAGAACGTCGCGCTGCCTCGCGGCTCTTG
ACCCGCTCTCCATGACGCTCAAGAATCATTTCGATGACGAGAACACCAAGAACGAAGATGCCGAGGGCCACTTTTCGGCGTTCCTCGTGCTCGACTCACC
GTACGTCATGGTCGAATACGGGAAGCTAATCCCGGTCATTGAACTCAACGTGACGCTGCTTGCTGTGAACCAAATGGCGGTCAATGACACCAGCAGCAAT
AGCACAGGTCCCATACACGCACACATGTGGACGGCCAGTCGCTTTGAGCTGGACGTACAGGTGTACGACGCCCAAAAGGCACTCGTGAACCAGATGTGGG
TGCTTTACTTAGCCCAAGATCGCACACTGCAGCTCCAGTTCGCGGACGAGAAGGACTACCGATCGTACAACATGCGCGGTGAGCTCACGACGCCCACGAA
CGTACGGTTCGTGGGCCACAGATTTCTACTCTGGCGCGGTGCACGTTGCAATCGTCCCATCTCAAGCTACACTCCTGCTGCTCGACGCCCACGCGAGCGT
CTATCCTGAGACCTCGTCGGCCAACACGAGCGTCGAGGGCCTCAACGGGTTTGCAAGCTTTGAGTGGACCACCAAGGAGTTGAATTCGTCTGCTGGCAGT
GACGATATGAAGCTGCTGATGCTAGCCAACTTACGCCACGCCGCCTCGTTCAGCACGCAGCAGAATGCGTCCTTTGAAGTGCACGCCAAGCTGAGCCATC
GCACGCTCAAGTCCAACATGACGGCCGTGCTGGGCCACGAGTGGGAGCTGCAGGAGAAGCTACCGGGCATTGGCTTTGACGCTGTGCAGCAAAGCACCCA
GCCCGAGTACCTTGACGCAATCAAAGTGGCGCTCAAGAAATCCAAACAACACGCCTGCGACCGAGGATCCGTACTTTTTCGGCAAGGAGGTCGATCACCA
GGCGCCGCTCGCGCTCATCGCGGACGCAGTGGGTGAGCTTCAGACGCGCGAGGAGTTCCAGAGCGAAATGGAGAAGTGGCTCACGCCTTGGATCATGGAC
TCGAACAGCAATGACTATGTGTACGAACACGTAAGGTGTGTATGTCAAAATGTACTTTATGATCCGCAACAAGATTCGAATGACTGACTTATCTCGTATT
GTTTGTACCGTGTTGCAGCACCTCCACTACAGCTACCTGATGTACTCGCTTATGCATGTACAACTCAAGTAGACGTGGTTCACGGTGAGCGGGGGTCTGG
TGTGTTGGCAACTCGGTTGACACATCCACAGGAGGTGCAAGGAATCCGAGCGGGGTTATCAACAAAGTCGTGTACAGTGAGAAGGTCCTTTTTGGCCACA
AGCTCTCCAAATGTTTGCTCAAATACAGAAGTCATCGGGTCGTTGACTCGGATCTCGAGATTTTCTTCCCCGCGCCGTGCTCTTGCAGACCAATTGAACG
AGCCGTTATCGTTGACGACACCGCCGACTATGGCAAACCTGTTGTGCATGGAGATGCTCCGGCTATTAGCGTAGACCTCGATACCAGCTTGAACGAACGA
CTAGATCTGGGAGCCTTGGTTCAACATGCTGGCACGGTTCACCACAACACGAACTATGACGCTTCGGCGCTTTGCAGCGTGCACGGCTGCTCCCAGTTCT
TCACAGATTGTAACGAACACGTAGATGTCCATCGTCCCCTCCGTCATGTCCAAGTGCGCCAAAAGTCGATTGAGTAGGTCATGATGCTTGTTGTCTGGCC
AAATGAGTACCTCGTCTGCGGCCCTGTTCGCTCGGAGAGAAGCTCGTGTTTGGGCAGTGCACGCCATCACTTGTTGCGTGTGCTTCCTGAGAAGATCCAC
ATGTGGGTTCTCCCGCTGTTCAATCGGGAGCGAATCCTAAATCGCTTTCCAGATCGTATTGGGCAGCAAGTCGACAATGAATGCGACAATCGACAACGGC
CACCCGAGTGATGTCCATTCAGGTAGCTCTCAAACGCCAAGCCATGAAATGAGCTGAGTCGTGGCTCATGATGCCCCAAGACGCGCACACGGAGGCGTAG
CACGTCCTGGTGTGCCTGAAAGAACCCTAATAATCGAGCTGCTGCACCATCTCCTCGCTCAGCAAGACGCAGAGAGCAACGACCATGAAACAGAAGTATA
TGAACGTGCTCAAATGGAGCAGAGACCTGCTCGGGACGCGTCTGTCCGAACAAGAACCCATAGCTCAGGGTTGGAAAAAAGAGATAGCGGCTATTCTGCG
CCTGGAGGTCGCCAACGCTACAGCACGATGGGCAGGAGGTCATTTTCTACTGACTCGGAGCTTAACCCGGATGCAAACGGCGCACCAACATTCGAACGAA
GGGATGTGGTTCTGGTCGACTTTCCACTGACTCGAAAAACCGTGGATCGTGGACGAAAGCGGAGCCCAACTACTGTCGAAGGCCCATCGAGTATTCAAGG
CGTGCAGCATAGCACAACTGGGCCTCACGAGAGACTCGTCCCACTAATACTCCTGCAAACCACTGTGTGGTGTCAGCGACTGGAACCTGGTACAAATGAG
AAAGTAGACACGAGCGATGATCAGCATAGTGGTTTGTGCGCCCGAACTCGCGATCGACAGCGGACACTGGGTCTCGCAAGACCTAGAACTCTGCTCTTCT
CCAAATTTGAACTACAACTACGAATGGCGATACCAACGAGAAGGTGTCGTACACGGCACGACGACTGTCGACGGAGAGTTCCAAAGCATCGAGTTCCAAT
ACAGCATCTTGTGGACAACAGCATCAAGCACCCAGTGGAGGGCTGTGTAGCAGGACATTGAGGCACTCCAGGAACTGCACAAGACTTTGGAAGTGACGTT
CCTGCCCCACACCCACACCACGGTGATGGCCTGGTATGTGGGCGTCGCGATCAAGAAGAAGTAGATTCTCAAAATGATGCAGAAAGTCACATGGAAGCGT
CTACTCCGCGCCGAACTCGCTGGATTAGTGACGGCGGTGGAAAAGAGCGGGCGAGCAGCACATATGGACACAGCGGAGCTCAGGAGTCGTAGGGCCAGGT
TCTTGATGACCTCATGCACAACCACATACCTGCGTCGCTTAACTCAATGTTCCCCAACGCCAGCTTCCGCTTCGCCATCAGACATCAAATCGAGGTTGCT
GTCGGTTTCTCCGGCCGAGTGCTGTGCAGCAAATCTTGGCTAGCTGGAGTTTGTAGCCGTGGCGTTTCTCTTTGAAGAGGCAGCAACGTCGCTGGAGATA
ACTGCAGCATTTTCCCGCACATCGGCTGCCTTCGAACTCGCGCTCGAGCATGCAATTGCCTCAGCCTGTGTGACACTCTTTGCTCGCTACTTCGCCTGTT
CGACATCTTGACCAACTCGTGTAGCCCTCTCCTCGGCAACTGTAGCGGCCTGAGAAGCGATTTTGACCCTGCGCTGAGCCATCGCAGACGCGTGATTGGC
CCATTCCAGTCTCTCATGTGCAAATTAGAGGGTTTGCGCAGCACGAGCTGCTCTGTCTTGTGCTACTGCGAGTGTTTGGTTTGCCCTGCTGGTCATTTGC
TGAGCGACTTCAACAGCATTTGCAGCTGTAACTGCTTGCTGCTCCTGGGTCATCGCAGCGTTAAATGGAAGTGCCCATGCTCAGAAGATGAGCATGAAGC
ATGTGAAGATAGGGAGTCAATCTGGGCGGCTTCGTTATCGCTCGTGCTCGCGGTCACTGAAGAAGAACTCAATCGACGCCAGTCGTCCGCATCGTCTGCT
CACGTACAGCTGCAATGGCTCGGGAGACGGCGCTCGCCCATTCCATCATATTGTACTGGTGATGCAACACGGCCATTTCAATATGGCAACTAGTTGCGCG
ATCCTTGTGGCGCGGCGACTGTAAGCGAAGGCCCAACGACTTTCGCGAGAGCCGTTCGAGTTTTAAATTCGTTTGGTTGACGTTGCTTCAAACGTTTGGA
GCGACAACAGGCGCACCCATAGTGGAGATCGAGGGCGGCAGGCTCGCGTGGGTCAAGCTGCATACTATGCAGGTCTTCTGTGAACTGATCATCATTGACG
CGAGCACGCATGCTCCGGTTCTCTCTGGTCACGCCATCGACCGCAGCCCTCAGGTCGAGGATGAATAGATGAAAGTCTCATGCAGTATCTCAATACAATC
TACTCTTTACTTCATAATATCTCTCTCACTTCTGCTGACCACCATGCCAGGAGCTCGTGAGCGAATTTCTCTGACTGCGAGCCAGAAATGAAGTGGCTGG
GGCGACACTTCCAGGTTGCCTCTGCATCTCAGCAATTTGCTCAGCGAGGTCTTCGTCTCAGTCGCTCTGACGTGACATGAACGCTTCCAGCGCATACCAA
ACCAGGAGCTCAACTGCTCTCTCCTGTACTCCGTCTACTACCCAAAAACCATT