Description :
Non Conding Region
Location :
Scaffold_1:38206- 38625
Sequence
419 bases(100 bases per row)
TGGAGAGAGGAACGCACCACCAGAACGCTTCACGGTCAGCACCGAAACAGTCGATGCAGTCCGACAGCAGATGAAACGTACAGCTTCTCGGCCACCGTCG
GTCCCTCGGCGGGAACCGCGATGCCTCCGATGCAGCGGCGGCCAGCGGCGCGCGCCGTCNNNNNNNNNNNNNNNNNNNNNNNNNCGATCGCAGAGCTCGT
GCCAGCATCTTGGTCGTCGTCCTGTGCTTCCGCCGGTCTTGCGGGGGCCGCACACTTCGCAAGCCACACACAACGACAGCGAATACCGGTCTCATATCGG
TGTCATACCGGTAGATACTGCATAAATAAATATCCTCACAAATAGGTGCGACTGGTCTGTAACATACCCGCACAACTTGATACCTGTCCATACGGAGGAG
AGCAGCAAGGCGGCGGCGA