Description :
Non Conding Region
Location :
Scaffold_1:37994- 39356
Sequence
1362 bases(100 bases per row)
TAAGAGGGCGAGGGCTTGGGAGGGCCAAAGAGCAGCATCCACGGCCGAGGCTGAGATAGGGACCAAAGAGTACTCGACTGCGAGTGAGCGAGTGTATTTA
TATTCCTAGTGGCCAGGCACTCGAGCACACTGTTCCGACAGGCAGGGGCGCCAGCCGACTGATTGTTATCTGAATAATGGAGCGGGACCCGCACTTGGAG
AGCAAGTCGCGTCTGTATGTTAATGCAGAGACAagcctcggcgtcgagcCTCGAGATGGCTCTGCGCCGCTTTACCGGCCGAACCAGTGGtgtccgagca
gctcgacgggATCTACGTGCGCAGGCGCGTCCGGCTTGACGCTACACTTGGACTTTGTATGTCGAGGCCAATGGATGGCGGCCAAAATTGACACCATTTC
GGCCAATCGTGAGCGAGCTTCGAAATCCTACCCATAAGTCAAGATGTTGATGTTGCCGGCTCGTCTCTTGAGGTGTCCGTAACTACATGTAACCAGTACA
TAGTGCTCCGTATGGCTGCCAGACTCCTCATCTTCGGGCTGGGCTCGccgcctgctcttcctcgcttCATCAGGTATATGTAGCCCCTACATACACTGAA
CATGTACACCGAAGCTCGAGGCGTGAGGCCATTCGATGCCTGCCAGCACCTGATTACAGCAGCCGATCAGGATTAGATGATTATCGACGCAAACAGACAA
CGTCTTACCGACCATTGCAACATATGGTGCCCATCACTTACTATATTTGTATGGGAGGGATTACCTCTACAAATCCAACAAACGATAGTGGCACAGTCGG
GGTGACAGCGTCCAAGTGACCAGCCGCGCTACGCTTGGCTGGGCGCCCCNCCGCGcgggtttgctgcggcttcgCGCACTCGCACCCGCTCGCCTTAGTC
GATCCTCTGGGTACAGTCTGGATTGGCTGGATGCACACATAGTGTCGTCATTTCAACGATGTCGCCCAGCCGTTTATGGTGTTTTTCAGTGAATGGTATA
GTGTTTGTCATATTTTGTGACGCAAACACCGTCTTTGCGTCTTTGAAAGACGACACTCGAGTCGTGCAATTGTATCTGACACCTCAAAACACTGCAAGCA
GgcgaggaatttccataattcaGTGAAAATCACTGAGATTTGTCGAAATGAGGTTTTGGAATTGCCTCAGTAGCCGTGTGTTGCTTCCAAATTTCAAGTA
AAATGCGAATCGTATAGTACTATGAAAACTACTATCCTTAGATTACTACTTACACGAGCTCCGCTGACAAGCCAACATCGTCTGCTGGACTGTTGATACC
GATGACTGCGTGCGTACGACCTACAAATCTACCGCGCTGGCTTACTCTAACACCATTGTTTT