Description :
Non Conding Region
Location :
Scaffold_1:37991- 38211
Sequence
220 bases(100 bases per row)
ACGAAATGAAAAGTGAAGGGATTGCGGACGACGGCTTTGATTGGCCAAAGCGGTACTCGAAAACGACTTGCGATTGGACAGATTTAAGAACCTTTTTGAT
GGGACAGTTTGCAGCATTTTTGAAAGCTGCGACCGTTGGTTGACAGGACCAAGCGTTTCGGTCTTGGCGCCATGTCGCTCCAGCCCACCATGAATGCTAG
TTCTTTACTATAGCGTGTGC