Description :
Non Conding Region
Location :
Scaffold_1:37981- 38827
Sequence
846 bases(100 bases per row)
CTCGCTCGAATGTGAAATGGCTCAGGTGTAGGACAGACGAGCGGGGTCTCCGCACCTCGAGGGGATCATGGCGCGAGCCGATCAGGCGGAATTGAACCGG
AGCCCACCAATCGAAGAGTAGGTCCCGAGGAAGGCGTGCGTGCGGCATTTTTGTGTTGCTGCGGCAAACTTGACTGGACAGCAGACTGCTGGGCTGGAAA
CACTTGAACTTAGTATGGAGGAGAGTACCGTGAGAAACAAGGGTCCGTGCACCGTGCGAGACGGAATAGTGCAAGTGGTTGAAGTACAGTAGTTCGCTCA
ATTAGACACAGATTATTGTACCGTATTCCACAAATAGAAATGATTTCTCGCATGCAGCTGATGTCAGCGATCGATGACATCGGCTTCTAGCCTTCACGCA
GTAAGCAGTGCCATTGCGCCCCGACGAGCTTCAAGCGCCACGAGTGATCGATCTGTGTGGGTCGTTCGCCGAGGACCGTCGTTTACATATCATGTTTGAT
CATCGCGGCCAATGTTCAACAACGAGGTACCGTGTCGCAGCACCGGAAGCCTTGCTCTCGAATGCCCAGTGCCTTGCGGGCTCGTTCGTGCCAAAATGCC
GGTCACACTGTGACTCACAGCCTTGAATTGGCGTGCCTTGCCTTCTATGCCCACATGCATCCGGCCAACTGCAAGTGGAGCGGCATCGAGGTGACAGCAG
AGATTCGTACTCGGCCACGTCACTCGGCCGCAGCCCGAGCCAGAGCGCGTGCGTCACACTCGCACTTAGCGGGTGCACCCGTCTATACCGATGCCGCAGT
TGCTCACTTGCCGATCAAGGTCATTCGCCATTTTCTCCACGAGTCC