Description :
Non Conding Region
Location :
Scaffold_1:37733- 38295
Sequence
562 bases(100 bases per row)
TTCCCTAGCGCATGTCACACCCACACACACATACACCCCACATGTCCATGCATCTTCCCAATCTACACGGATTTGGGAACCCAAAATACGTGTTCACACC
CGTTCAATACACGTTTTCGCCAGTAAACGCACGGTGTTAAACaGAAGTTTCGACCATCGCTCTGGCTCGTGGCGTACGTCAAGCACTGTGATTGGCCAGT
CAGTTCGCCAGAGTGAATGTCCCACGTCAGTCGATCCCATCTGGGCCATGGCGATGGACGGCGGCGCTGCCTCCATGGCATGGCTTCCTCCTCTCCTGCC
TGGCgTCCTATCGCcTTCCTCTCATtCTTCGCCTCGCCTCCcTtGTGCCATCGACCTCGCTCGACCTCCCTCAGTATTGTCGTTTTATCCCATTAGATTG
GGTCCCCTCCCCTCCCCTCCCGTTGCGGTGCCAGAGCAACGCACGGCTCCTcTTGACGACTCAGCTCGTGTCTCCAGCACCGCCCAAGAGACACGTTAAG
CGAAAGCCATCCACCAGCATCACGGTAGTGGACGACAAAGACAAGCAGCCAACACGCTGTGA