Description :
Non Conding Region
Location :
Scaffold_1:37706- 38610
Sequence
904 bases(100 bases per row)
CTCGTATCTTATTTGTGTACTGGTTGAGGACTCGTATCTTATTTGGGCTATGTGCCATTGTATCTTGTAGAGTCACTGACGTGGCAGCCGGAGTGAGCAG
CAAGGGCGACACCACCACGTGGTCTCGCAGAACGACGACTTGAGATTACAGCTTCGTCTCCTGAGATGCGCCCGTCCCACACACGACGTCACTACCCCGC
CTTCGTGGTGGCAAGGGCCATGGCGGTTCCGGACGAGGCTCCGAGTTGCCGACGACCGACAAGTGGTCAGTCTCGGTGTTTGAGCGGATTGAAGATGCGC
TGGAGCGCCCGAAACGCCCATCTCGCCGCTACGCGAACCAATGTTTCGGGAAACCAGCTCGGCCTTCCAAAGACGACCGACTCTCTTTATCGCCACGTGA
CTCACAGCACGGACCACCGGCACTCGCGTTCCAATTGGCATACACTGTATTTTATACTGCATGCCGACGTGGCTTGGCTCTTTTGTCAAGCTCGCTGGCG
CGCCTAGCTCGTTAGACTACCAGCGTACGAGAGACAGCGCTGCGGAGCCGCTTCTTCCGCGACTACAGTTATAAGCGTCGGGTCTGAGAACCCGCAGGTT
GATTGCTTCGGGCGTGCCAGCTGGTTGGCGATTTGACTTGGTGTTTGTATGCCGTCGCACTGCTCATACGTTCCACAGCGCAATGTGTCCTCGGTGTGCG
GACAAATATAAAACCAAAGTTTTTATTCCTTTCTCGGTCTACATTCTATTGTATACAAGTATATGGTCAAAGGTGTGTATAAAATACACGCGACGCATAT
TATAGCGTCAAACACGCGCATCTGTCTCGGGATTCGAACGGGTTGCTCACTCTGCGGGCTCTCTCGCGCGAACGCTGCGGTGGCCATGTCATTTCCCAAT
CTCC