Description :
Non Conding Region
Location :
scaffold_1:37513- 37655
Sequence
142 bases(100 bases per row)
ACTTGCAAGAGCTTCGTATGATACAGGCATAAATAAAGTGGGGTGACGGTCGTGAATGAACACATACACAGTAGGGTCCCTAGTATTTAGCATGAAAGCA
GAGATACACATCTCCGAACCTTCCTCTGCCTGTGAGGGTATC