Description :
Non Conding Region
Location :
Scaffold_1:37494- 37615
Sequence
121 bases(100 bases per row)
CCATCGGCAGCTCAGCCAGGCGTCGTTACACAATCGTCAGGCAGTACAGCCGTTCTCGTTCCACTTAATGTGCGGAGTATTCTTGCCAAGGCGAGAAGGA
AACGACGGCCTCCTCCCTTCT