Description :
Non Conding Region
Location :
Scaffold_1:37384- 38623
Sequence
1239 bases(100 bases per row)
GATGAATCGAGTTCTGCGACGCGCGCTAAGGCGAGTTGTCGATCGGCCATATTGAATGCCGGCAGGACCACGTACTAGTAGCAGAGTAATTTCAAGTGTG
TGAAAAGGGATGAGGCAGGCGATTGTTGGCGTATTTTGCCGCTTTTTCGATCTTTTTAGTTATTGTTCCTTTAGCGGCTTTTTGAAAacacttggaattt
gtatgcACAACTGACTGACGATCAAGCCATCTAGGGCATGTTAGCAGTATGTTATCGACCGGTCGCCTTAGAACTTCTACTGGCTTTTGGTTGCGCCTTT
CCGAGTAAATCTATATCTATCTTACCTTTACAAGAAGTACAGGTGCTCCGTCCAAATACATTTGGCACTCGGGTTGCGACTCAAATGCCAATTTCCGGCT
ATAAATTGCAAGCCAAACGCCACTAACTTACTATCGGATACTTAGTTAGTGCCCAAGTCGAAATCGAAGCATGTTAGATCAATGTGAGTGGAAGTTCACT
GAACAGCCCTCGGCCGTCTATCTTGCTTACTAGATGGTCGTTGTCATTGCCTCTTGAGAGGATCTGTAGTGTCAAACATGTATCGGTGCTTGTCGACCTT
GTCGACCGAAATAAACGCAAGCGACTATCGGCATGAACGAAGAAATCGCTGATTCCTAGCCTGGTAGTACCTATGTTTGGGTATCCACAGACTGACGAAG
TACGGCTTATGGTATCGGTGTGAGGTCGTCATCGTTcgtgggggggggggggggggggtgaAAACCGCATCGTTAGCGCCGTTACTGTGAGTGGCAGCAC
CGGGTTCGAAGCGTCAGATCCGAATGGTCCGTTGAGTAACAATCGCTGCTCTTGTGATTTGTGGTATTTGCAGTCTGTCTGCCCAAAACTGATCGATCAA
GCGTTCGCTGGTAAGCTTCCGCTCGTTGCCAAGACCACCGAGTTCAACGGCTGGAACCTTCTTTCTGCAGTTCTGAGCACGAAAGGCGCAACGGACTACC
GGCTCGAATCCAAAAGTGACGATCTTCAGGAGATTCGACTAGTCTGAGTCAGCGAGAAACGATAAAACATGCAGTGCTGATTCACGTTACACTCAAGTAG
ATCGTTAGTTGCAACCTTACTGCGTGGTTGGCACTGCTCTACAATCATACGCCATACGCCGCACGCTTGAATCCTCGTCCCTCTTTTCCATGACGAACaa
ttgtcgtcgtccagaGGCTCTcgatgtggtccacaaacT