Description :
Non Conding Region
Location :
Scaffold_1:37377- 37424
Sequence
47 bases(100 bases per row)
GGCAAAAGATACCAAGCGATGCATTGAGCGAAATATATAGAATTGTC