Description :
Non Conding Region
Location :
Scaffold_1:37208- 38573
Sequence
1365 bases(100 bases per row)
CAGCTTCAGTTAACATACTGATGCTCGAACTCTGCTATGACAGCATGGCAACCGCGTCAGCATGACCATTTAAAGGAACTCAAAATAACGAATCCTATCC
TTTGTTGCCAGCCATATCCACAATCGCTCCATTTTGTAAGATCAGCGAAAGAGCTGGGATATGACCATTCAAAGAAGCAAGGAGAGTGGTATTGAGCCAT
CGTTTCCAACCATGTTCACACTCGCACCCTTCTCCACTAGCGTGATAACGACACCAATGTGTCCATTTGCAGATGGAGCAATATGGCGGTTGACGCATCG
TTGGAGGTCATGTTCACGCGGCACTCTTCTCAAGCAGCAGTAAAACAATTTCAACGTGATTCATCGTCGAGCGTGGGTGTGTCTGTGCTCGCAGCCTTCT
CCGACAGCAGGTTTTTTGTTAGAACCAACACGTTGCGCAAAGTTCGCACTTTTTATGCGACATGAGAAAACTTGCCTTTTGTATTACCTACAGTATCACT
TATGAGAGGGCGTTATCGCCTCGTTTTCAACCCAGACCCAGAAGAGCAAATTGAATATGCCGGGTGGAAAGCGGCAGCTCCTCCTCTCCGAGGACACCGC
CGCGCCGCGGAAAGCTCAAAAGGCGCGAGNNNNNNNNNNGTACACGCGACGTGCCTGCGAGTTGGCAATGTACGTGTCCCAGAGCGAGTCCATGTGCTCC
TCAGGCGAGGCCGAGCCGGGGATCTGGATGCGCTGCTTGCCATCGCGCAGCACGATCACGTTCTTGTTCGGGTTGGCAACGATGATGCCGTAGCCCTCGT
CGATGGCCTTGCGAAAGTACTCGAGCATGGATCCGGATTTCACGCCCGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGTGTCGTAGTTGCCCGAGACAAAAAGGTTCGCCTTGACAGGCGCGTCGGCCGATGGCA
GAAACACCTCCTTGAAGCCGAGCTCCTTCTTCATCGAGTCTTGCACGTACTTGACGACAGCGTTGATGATCTCGTCCTGGTGCACGGCGATGTCGGTCTC
GTCGAGGCCCTTGCCCGTGGCCTTGAGGTGCACCATGCCCTCGGCGTCCATGGCGTAGAGCGGGTGCGAGAACGGGATCTGCGGCCCGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGTTGGAGCTGAACTCGGTGCCGTTGCTGCTCATAGTCCGGCCGTGGTGCGGCGGCGGGTATCCA
GACGTCGGGTACTTGTCGTCATTGCTCTGCTGTTGCTGTTGCTGCTGCTGCACGTGGAGTTCAGG