Description :
Non Conding Region
Location :
contig_1:36888- 37005
Sequence
117 bases(100 bases per row)
CGTAAGCCTGCGGCCTCGAAGACGCCCCGCCGTACGGGTAGGAGCCGTAGTACGGCTGGGAGTACGCATAGGACTGCGTCTCCCGATAGCCCGGATAGCT
CGGCCGGTTCTGGAGCT