Description :
Non Conding Region
Location :
Scaffold_1:36094- 42454
Sequence
6360 bases(100 bases per row)
ACGTGTACTCGGCCTGGAGGGAGTTCGGGGCTTCGCCGGGAACGATTGAAAGAGCGATGGCGAAGGTTGGCTACGGAAGCGATGATTTTAAGTACATCGT
GAACGGCTACAAGGATCACCTGGAGCACATGAAATACGTTCAGCTGCACTAGACCGCTTGAGTATCTGGATACACTTGATGTTTGCCGCCAAAAGAGAAA
AGCCGTAGCATTTTACGGTTAGCTGAGTCTCAATGCAAATTCACTCTTTCTCCTATTTGCGTTTTGAATTGAGATATGCGCAAACGCAAGTCAAACGCTA
TCCTTTCGAAAACAGAAAATGTCGAATAGTTACGTTGTTAGTCTCTTCAATGCCCTACTACTCGTTTATACTGGGAGCCCAGCGGAGACCCGCAGACGGG
GCTCGTAGTACAGGGTAAGTCAAGCATGTGGGGCTGCCCGCTTCGCTTCGCTCGACGAAAAGAATTTCCAATTTGAAATTTATGAAATGGTTAAGATTAC
GATTGTCCAAATTCGCAGTTCGATTTTTTTTATAGAAATTTTGATTTGTGATCATCGCGCGACATGCCGGAACTTATCAAGAGCCACCACAAAACTAGCA
CAGAGAGCGTAGTAAGTAACCCTCGCGCCTAATGTTTTTGTTTAAGTCTAAATAGTGACTTCAGTTAACACGGCAACGCACGCATCAAACTAATACTTCG
CAGTACATACCATAGGTCCACCAAAAGGATTGCTGGAGAGGGGCTGTCCGAAGTGCACGCTGTACACTATCGGGCTCGCCCCCATGCCCCGCTACGTAAA
AGGAAACGAGGATATTCGTGGCGGCAGAAGGAAATCAAAGAAGCGAAGTGAGAACGAAACCAAGGGATTAGCATCAATGAACATTCCAATTCAGCCTTTT
TAGCTCGGGCGCTTTTCTCCCCCGAAGAGCAAGAGCTGCCTCCTTGTACTGATGGTTCCGTGGGACAATAAAATAAAAAATGTATTGTAGGTTTCTTTCT
GTCGTAATCATACCATCCCACCAATAATCAAATATTTTTCTGGGATAGGAAGCAAAGTTAGTGCTGCTATCGCACACCAAATAGGATTATATCCGTGGTA
CATCAAGTCAAACGATGACTCCTCTTGACATTTAACCTGTACATTTTCTTAAAACTGGTACGGCTCCGGTGCCGCACTGGGCCCGTTTATATGCGTGGGC
AGATCGAACCGGTGTGCTACCGACGACACTGGTATGAATCATTACAATTATTAAGCAGGGTACGGATGGACGAATTGAAAAAACGTGAGGCGGATTGTAA
CAGCACTAGCGACAAGCATTTGCATTTTCTACTAGAAATTTTCTACAAGCTGCAAACAGATTTTAGCCAAGGTTCGCATTTTTAATTTTGTAAAGCATTG
CCGGTTGATATCTGGCATCTACAGTTTAAGATAAAAAAAATCCAGACAGATTTTGCGGCTGCGAAGCAGGCGCAGGAGATGACAGTAGCTAGTAAGAAAA
TTAATTAATAAAAAAATAAAAGGGATTCAAACCAAATCCTATTATCCCAGCCTTCGCGGAGCCCTAGTAGTGGAACAATATAGTAATAATTGTATTGAGC
TTATCGTTTATCTTGATATGTGTATGTAAAAAAAACGACAAATATTTGGCGCTGACAAAGCTCAATAATACTCATTGCAATACGCCTACTCCCAATAATC
AATTATGCTAGTGGAACAATACCGTAATAACTGTTTTTTAATTATTTTTCGGACCCTAATTCCACTGTTGGATCCACGCTTGACCTATCTTCCTAGCGGC
GCTGCCAAGTTTGGCTTCTCTCGTATGTTTCGTCGTCGTTAAAGTTAGCCACGACTCCGGCACTGCCCACTCGGTGGGCGATACGCATCACCTGAATCGC
CTGAGTCTTCCCAAGCCAAAAACAATTAGTTTTCCCTATGACCCATTCAATCTGACATTGTAAACGGAGTCAATCTGGCGGAGCATTTTCGTCATTCAGA
CGAAAGCACTAGCTCTGAGGGCACTCCGACCAACAGGTTTTAATCTGCTCGCTGCGGCTGCACAACATGCACCTTTGCATGAAGTAGAACAGTACGACCT
TCCCTATCCACAGAAGAACATAGGAACTCATCGCGCGCTGGAACCCGTGAAGCCGATTCTCGGTCACAAACACGAACTATTCGACCTTCTCGCCGCCATA
ACCGCTGGCAGCATCATCACAAAGCGAAGCAGCGTGCACACAATCGTACCAATGTGTTAACACCCTAACATCACTATGCAGCTCAAGTTTCTACTTGTCG
TGAACGTGCGGCATTCGCGTCTCCCGATAATTCTTGGCCTTGGGGAAGGTAGCGATTTCGCGCAATGACCGAGCGGCGACGACTGACGGCAGCACCACCA
AGAACCACGGCGCGGGTCCGGTCACAGCGCTTCCACCGCCTTCGCCATCAATGTCTTTAAACTGTATCAGCCAAGTTGAAGTAATGCATGTTCTAGTACA
CGGCTTTGAGTGTATAAGTCAGTGATGTATAAGTTTTGAGGGCTGAACAGCACCGATGAAAGAAGCGGTGGTATTAATACGACGTCAATTATGTCGAAAA
TCGCGGACAAGATCCTTATGAAGGTGAGAATGGCGCTGTGGCTCGAGTTTGGCAAGTCCGACGGCTACGTCAAGAAGGCGCTGAAGATGAAGGGGGTTCC
TGGTCCTGCGCTGACGTCACACATGAACTACGAACTGTTTGTGGAATATGTGGACAAAGCTGAGAAGTATCGTCTGGATAAATGGGCCCGAGGAGCAGAG
GTCGGAAAACAATATTGCAATACAGTAAATAATTGGGTTTTCCAATAAAAATCTTTATTATTGAGCGCCTCGGTTTTCAATACAATATCATATTGACCCA
ATTATTGACAATACATATGAAAAAAGACCGCTTTCATAGCATTTTTGACTGATGATGCCAAATTCTAGCTGCTAAGGGCATGGATTTGCTTAGCACCACA
CCCAAGCAAGTATTCCATACCCTAATGACTATTATAAAGGTAAGCATATATATGTCCGTTTTACCATTGCTGAAGCTCGCCGGTAGAAAACAGCTTTGTG
TTGAGGCATCCAGCTTGAACCCACCCAGATTGAGGTGGACTGAGGTCGAATGAGGACTACTAGATTGGTAGAGACGAGTGGCACCAATTTAAGGCGCATG
CATGCCTTGCTGTGAATGAATCACTTTACAATTCTCCAACAGGTTAACAGCCGCAGGGGCTTCGCTGAGCTACAATTGCGATTAACAACCACGAACTATG
CAGCGCGAAACTACCAACCACGTTGCACCTACGTACGCTGCCGGCCTGATTCGGAGCTATGCACCTGATCCTTATGCTTATGGAAGCGGGCTTCCATCCC
AGCAACACCCGACACCAAGTCCGCCCACAACCACACAGCCTGCGCCGTCGACTATGAACCGACCTGATAGCCCACTGACGAGCTGCAGAGGCGATACGAC
CGGGTCATCAAGGCATTCTCGATTGAACCTTTCGACGGGTCCTCTGGCCCCAGTGCTGTAGACGCTGGCGCGGCGCCGTGGCTTCAACGGTTCGAAGCCT
TACTTGGGACCCACGAGGACCTACATGGAGTTCGACTATCAGACAACGTGAAGAATGCACTTTTGTTCCAGCAGCTCCAGGGCACAGCAAGCCAGTGGTA
TGTCACCAACATAGTGGAGCTACGTAGTTATTCGTTCGTGGAGTTAGGGCGCCGATTCAAACGCGAGATCGGATCGAAGCTGTCGAAACAGGAAATATTG
ATCATGGTGGCGAATGAACGGAAGCGGGGGTCCGAGACTTACCACCAGTTTTCACTTCGGTTACGATCGATGGCTGCTGCGTCGACTAGAGACGGACTGG
AGACAGTGGAATCTAACAATTTCGCTTTAAGTGCCCTCATTTCCAACGCATGGCCGAGACATGCAGACTCGTTGCGACTGATTATAAACGAGGACTCTGC
GGACCCACTTCGCGAAATGGAGCATGCTGTATCCCGACTGTGCGCGCTCGCAAAGAGCCAAGGTGTTGTGCTGACGCGTACGACCGGACATGGAAACCAC
GTCACTCGCCCGGTCGCGGGGAAGCGGAAGTCGATGGACCCGAGCGTGAAAAGGGAAAGTAGACAGCGAGAAGTCAAGCGCACTCGACGAGAACCTCGCG
ACTACTCCAAAGCCCGGTGTGGTGGATGCGGTGAGCTCGGCCATACGACCGGCTACCACGATCGTTTCGTAACCCGTCAGCAAGGGATGGCTCACGCTGC
AGCAGCTAAGGAAGAGTCACATCACTCTGACAATGATGACCCTGAGTTCGGTAGGCAGGAAACGAGTGACGCCTCTGAGTGAAGACAACGGGAACCATGC
AATGAGCTACCACCTCATCATTTTGACCCAGGAGCTCAGCGTGGCGCCCCGCTCATTGATTCTGCCTCGACTTACCACATCACCGGGGACCCGACAATTT
TATCTGACCTGCATGACTGTGAAACTCACGCCGTGGAGCTTGCGGATGGACGCATGATTACGGGTAACCAGTTGGGGAAAATGATGATTGACGAGTTGCG
CGGGATAGTGTTAAATGATGTCGACTACGTGCCTGGCTTCAGCCAAACGTTGATTTCGGTGAAACGATTGATCGACAATGGAATGAAAGTGGAGTTTAAT
GAGCACGGTTGCAACGTGTACGGCCCTCCGGTGATGCAAGGAGTGGCAACGTGCGGTGTCTACTCACTGAAGCTTCCGCGTTGCTTGGCTGCTGTTGCAG
TCCAACCCAATTCTATCGACGATTTGCATCAAAGACTAAATCACCTGAACTACCGAGCGATTGTGCAACTGGCGAACTCCAACGCTGTCAAGGGATTAAA
AATCGTGGGCTCGACTATTCCGAACAAACCCTGCGAAATCTGCGCGCTTAGCAAGATCCATCGTGCCGCCGCGCCTCAAGAGGCTTCAAGACCAAAGGAG
TCACAAGATGAGGTCTGTCACGGGGATCTTGCAGGCCCCTTCAAGAAGAGTTACAATGGAAATCGTTACTACCTGGCTTTGAAGTGGAAGGGGCATACAT
CAGTGTATTTTTTTAAGCACAAGAGCGAGGCTGCCGAACACTTCCGAACGTACCTGAATGTGGTGAATCGTCGATTCAAGGACAAAAAGAACATCATGAT
ATTCCGGTCTGACAATGGAGGAGAGTTCCTGGGGCACAGATTTGTGAAGGTCTGTAATGATGAAGGAATCACGATGGAGGAATCAGAGCCGGATGTACAC
CACCAAAATGGTGTGATTGAACGTGAGCACCGGACTATCACTGAAAGTGCCAGAGCAGCGCTACTACAGACGCAGCTACCCCATTACTTGTGGGAATATG
CAATTCGAAAAATCGTCTTTGCACGGAATCGAGTGCTCAACAAGCGTGAACCTACCAAAACACCATTTGAAGTGTTTTGGGGACGGCGACCGGACCTGAA
GAACGTGAGAGCTTTCGGGCAACGCTGCGTTGCGCTGATCCCCGATGAAAAGCGGTCCACTACCTACAAGTTCCGACCCAAAGGTCGAACTGGTGTATGG
AAAGTGATCCTCAGAGGAAAGGATACTTTGTGTACGTCACTGGACGAGGTCACCAGGTCGTTCATAGTCGCAGCGTCGTCTTTCTCGAGCCACCAAGCAA
TCTGCCGACACCGTGTGACGATGACGAGGACCCCATGTGTGCTGGCAGTGACAGTGAGTCTGAGAATGATGGTGACGACTACAACGACCTGAATGGTGAC
GAGAACACGGATGCCGCCACCAATGGTACGGACAACATGAAAAGAGCACGAAAACGAGGAGGCCTCTTGCTTCACCCACGACGACCTCGTCGTTCCCACC
ACAATGATGCATTGCCGCTTCGACGTTCAGCTCGTATTGCGGGGCGGGCACTAAGCGCTGCAGGAGCAACGCTGGATGAGATTATCCAGGCACCACTCAA
TCTCCGAGAAGCGCGAGCATCACCACATTGGCCAAAGTGGGAAAGGGCTATCCTCGCTCGCCGAGATACAAGCTCTACGCGACAATGACACATTTGAGCT
GGTTGATCCTCCACCGGGAGTGAACATAATTGGCACGATGATTGCCTTCCGCGTGAAAGAAGATGAAAATGGTTCTATAGAACGCCTGAAAGCACGGATT
TGCGCACAAGGTTTTACACAAGAGTTCCTGAAGGACTAGTTTGAAACCCACGCTCCCGTGGCCCGACTGAACTCGATCCGCGTCTTCTTAGCGTTAGCTA
CGCAATTTGGATTGCGCGTACGCCAAGGCGATGTCCCTACCGCGTACGTGAAGGCGAGGC