Description :
Non Conding Region
Location :
Scaffold_1:36066- 36820
Sequence
754 bases(100 bases per row)
CAGTTGCCGCTGTGTGACTTGATGGCACCGTATTCACAGTCGTGGCAAGTCCGCGCGTCGGATTCTGCTGCGAAACGCTCGTTCGTGCCGCCACGTCATC
CATCCGGATGCATCGTGTATATTTCCGGACATATCTTTGCAGGTTGCAGGGGTCACCGTGTCGGCCCCCGATTGAGGTTCGGATGCATGCGCTCGGCAAG
ACGGAGTTCAACTCCCGGTCGAGACCATCGTATCGATGAGTCTCGTTCAGACAGCAGTAGGGCGCAACGACATTCTCAAAAACGACTTGAGAACAAAACT
CACAATACTATGCATTTCCAATTTTTCAACTTTGAAACCCCCTGATATACATGATTTGTTGCATATACATGTACATGCAAATACTGTACAAGTCGTCATT
AAACGCACCAGACAAAAGGCCGACGAGGTAGCCGTCGCTCGAGATGCCACCGAGGATCGTCGTGGCCACGCGAACCGTGGCGTTGAAGTCCTTGTAACAT
GTGACGATCTTGACGGTCCGCAGATGCGCGCGAACGTAAGCGCGAAGCGGCTGGACGACGCGGCGGCAAAGTCGCGGTGGTCGTCAAGGCTGAGCAAGAG
TGCTCGGTAGGCGTCGCTGCGACGACCTCGCAAGACATTCGCGTGCAGGCCATTCGCTTCGACAAACGCGCGCCACGCGTCCGAGACAGGTCTCCGCTCG
TCCTCACGTCGAAGCTCGGCGCTCTCTTCAACCGTCCCGGCCGTCGCGCAAAAG